Biology: The Essentials
Biology: The Essentials
3rd Edition
ISBN: 9781260140705
Author: Marielle Hoefnagels
Publisher: Mcgraw-hill Higher Education (us)
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 13.6, Problem 2MC
Summary Introduction

To explain:

The process of divergence of two species from a common ancestor with the help of molecular clocks.

Introduction:

A biological molecule can act as a clock known as “Molecular Clock.” The molecular clock techniques use the mutation rate of biomolecules. The molecular clock is helpful in studying the evolutionary histories of organisms. The concept of the molecular clock was first hypothesized in 1962.

Blurred answer
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?

Chapter 13 Solutions

Biology: The Essentials

Ch. 13.5 - How does the study of embryonic development reveal...Ch. 13.5 - Prob. 2MCCh. 13.6 - How does analysis of DNA and proteins support...Ch. 13.6 - Prob. 2MCCh. 13 - Why is the fossil record incomplete? a. Because...Ch. 13 - Prob. 2MCQCh. 13 - Prob. 3MCQCh. 13 - The study of biogeography is most concerned with...Ch. 13 - Octopuses and cuttlefish are mollusks that have a...Ch. 13 - Ground beetles have useless hindwings. In related...Ch. 13 - Scorpions occupy every continent except...Ch. 13 - Prob. 8MCQCh. 13 - Prob. 9MCQCh. 13 - Which of the following would be most useful for...Ch. 13 - Prob. 1WIOCh. 13 - Prob. 2WIOCh. 13 - Why are transitional fossils especially useful for...Ch. 13 - Prob. 4WIOCh. 13 - Index fossils represent organisms that were...Ch. 13 - Prob. 6WIOCh. 13 - Prob. 7WIOCh. 13 - How did the discovery of Wallaces line demonstrate...Ch. 13 - Why is it important for evolutionary biologists to...Ch. 13 - Suppose that plants in the San Francisco Bay area...Ch. 13 - Many species look similar as embryos. What causes...Ch. 13 - Give examples of how the field of evolutionary...Ch. 13 - Prob. 13WIOCh. 13 - Prob. 14WIOCh. 13 - Prob. 15WIOCh. 13 - Prob. 16WIOCh. 13 - Genetic anthropology combines the study of DNA...Ch. 13 - Review Burning Question 13.13, which explains why...Ch. 13 - Review the Survey the Landscape figure in the...Ch. 13 - Write a phrase to connect fossils and biogeography...Ch. 13 - Add the following terms to this concept map:...Ch. 13 - Provide an example of ach line of evidence for...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Biology
ISBN:9781305967359
Author:STARR
Publisher:CENGAGE L
Mechanisms of Genetic Change or Evolution; Author: Scientist Cindy;https://www.youtube.com/watch?v=5FE8WvGzS4Q;License: Standard Youtube License