Genetics: A Conceptual Approach 6E w/ SaplingPlus (Six-Month Access)
Genetics: A Conceptual Approach 6E w/ SaplingPlus (Six-Month Access)
6th Edition
ISBN: 9781319125929
Author: Benjamin A. Pierce
Publisher: W. H. Freeman
Question
Book Icon
Chapter 13.3, Problem 21AQP
Summary Introduction

To determine:

The consensus sequence for the given nucleotide sequences:

AGGAGTTAGCTATTTGCAATAACGAAAATCCTAATTGCAATT

Introduction:

Pribnow box or -10 consensus sequence is written as TATAAT box. Sigma factor associated with the core RNA polymerase enzyme which forms a one unit is called holoenzyme. This holoenzyme binds to the -35 and -10 consensus sequences in the promoter.

Blurred answer
Students have asked these similar questions
Based on your results from the Mannitol Salt Agar (MSA) media, which of your bacteria were mannitol fermenters and which were not mannitol fermenters?
help tutor please
Q8. A researcher wants to study the effectiveness of a pill intended to reduce stomach heartburn in pregnant women. The researcher chooses randomly 400 women to participate in this experiment for 9 months of their pregnancy period. They all need to have the same diet. The researcher designs two groups of 200 participants: One group take the real medication intended to reduce heartburn, while the other group take placebo medication. In this study what are: Independent variable: Dependent variable: Control variable: Experimental group: " Control group: If the participants do not know who is consuming the real pills and who is consuming the sugar pills. This study is It happens that 40% of the participants do not find the treatment helpful and drop out after 6 months. The researcher throws out the data from subjects that drop out. What type of bias is there in this study? If the company who makes the medication funds this research, what type of bias might exist in this research work?
Knowledge Booster
Background pattern image
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education