
Anatomy & Physiology: The Unity of Form and Function
8th Edition
ISBN: 9781259277726
Author: Kenneth S. Saladin Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13.2, Problem 4AYLO
Summary Introduction
To discuss:
The definition and structure of a ganglion.
Introduction:
The spinal nerves are important because the spinal cord sends and receive signals from the body through the spinal nerves. The spinal nerve is composed of large number of nerve fibers or axons and resembles a cord-like appearance. The nervous tissue of the spinal cord is composed of organized cells that involve the body movements and send the signals to different parts of the body. The spinal cord tracts are stimulatory nerve pathways that pass the information through action potentials.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Chapter 13 Solutions
Anatomy & Physiology: The Unity of Form and Function
Ch. 13.1 - Prob. 1AYLOCh. 13.1 - Prob. 2AYLOCh. 13.1 - Prob. 3AYLOCh. 13.1 - Prob. 4AYLOCh. 13.1 - Prob. 5AYLOCh. 13.1 - Prob. 6AYLOCh. 13.1 - Prob. 7AYLOCh. 13.1 - Prob. 8AYLOCh. 13.1 - The position of the posterior and anterior horns...Ch. 13.1 - Prob. 10AYLO
Ch. 13.1 - Prob. 11AYLOCh. 13.1 - Prob. 12AYLOCh. 13.1 - Names and functions of the descending tractsCh. 13.1 - Prob. 14AYLOCh. 13.1 - Prob. 15AYLOCh. 13.1 - Prob. 16AYLOCh. 13.1 - Prob. 1BYGOCh. 13.1 - Prob. 2BYGOCh. 13.1 - Prob. 3BYGOCh. 13.1 - Prob. 4BYGOCh. 13.1 - Prob. 5BYGOCh. 13.2 - Prob. 1AYLOCh. 13.2 - Prob. 2AYLOCh. 13.2 - Prob. 3AYLOCh. 13.2 - Prob. 4AYLOCh. 13.2 - Prob. 5AYLOCh. 13.2 - Prob. 6AYLOCh. 13.2 - Prob. 7AYLOCh. 13.2 - Prob. 8AYLOCh. 13.2 - Prob. 9AYLOCh. 13.2 - Prob. 10AYLOCh. 13.2 - Prob. 11AYLOCh. 13.2 - Prob. 12AYLOCh. 13.2 - Prob. 6BYGOCh. 13.2 - Prob. 7BYGOCh. 13.2 - Prob. 8BYGOCh. 13.2 - Prob. 9BYGOCh. 13.3 - Prob. 1AYLOCh. 13.3 - The pathway and constituents of a somatic reflex...Ch. 13.3 - Prob. 3AYLOCh. 13.3 - Structure and function of muscle spindlesCh. 13.3 - Stretch reflexes; one or more examples; the...Ch. 13.3 - Prob. 6AYLOCh. 13.3 - Prob. 7AYLOCh. 13.3 - Prob. 8AYLOCh. 13.3 - Prob. 9AYLOCh. 13.3 - Name five structural components of a typical...Ch. 13.3 - State the function of each of the following in a...Ch. 13.3 - Prob. 12BYGOCh. 13.3 - Prob. 13BYGOCh. 13.3 - Prob. 14BYGOCh. 13 - arachno-Ch. 13 - Prob. 2BYMVCh. 13 - Prob. 3BYMVCh. 13 - Prob. 4BYMVCh. 13 - Prob. 5BYMVCh. 13 - Prob. 6BYMVCh. 13 - Prob. 7BYMVCh. 13 - Prob. 8BYMVCh. 13 - Prob. 9BYMVCh. 13 - tecto-Ch. 13 - Below L2. the vertebral canal is occupied by a...Ch. 13 - Prob. 2TYRCh. 13 - Nerve fibers that adjust the tension in a muscle...Ch. 13 - A stretch reflex requires the action of _______ to...Ch. 13 - Prob. 5TYRCh. 13 - Prob. 6TYRCh. 13 - Prob. 7TYRCh. 13 - Prob. 8TYRCh. 13 - Prob. 9TYRCh. 13 - Prob. 10TYRCh. 13 - Prob. 11TYRCh. 13 - Prob. 12TYRCh. 13 - The cerebellum receives feedback from the muscles...Ch. 13 - In the ______ reflex, contraction of flexor...Ch. 13 - Prob. 15TYRCh. 13 - Prob. 16TYRCh. 13 - Prob. 17TYRCh. 13 - Prob. 18TYRCh. 13 - Prob. 19TYRCh. 13 - Prob. 20TYRCh. 13 - Prob. 1WWTSCh. 13 - Prob. 2WWTSCh. 13 - Prob. 3WWTSCh. 13 - Some spinal nerves are sensory and others are...Ch. 13 - Prob. 5WWTSCh. 13 - The anterior and posterior horns of the spinal...Ch. 13 - Prob. 7WWTSCh. 13 - Prob. 8WWTSCh. 13 - Prob. 9WWTSCh. 13 - Prob. 10WWTSCh. 13 - Jillian is thrown from a horse. She strikes the...Ch. 13 - Wallace is the victim of a hunting accident. A...Ch. 13 - Anthony gets into a fight between rival gangs As...Ch. 13 - Stand with your right shoulder, hip, and foot...Ch. 13 - When a patient needs a tendon graft, surgeons...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Nutrition and Diet - GCSE Biology (9-1); Author: Mr Exham Biology;https://www.youtube.com/watch?v=SFE1DfAlipo;License: Standard Youtube License