BIOLOGY THE ESSENTIALS CONNECT ONLY
3rd Edition
ISBN: 9781264735433
Author: Hoefnagels
Publisher: McGrawHill
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13, Problem 7WIO
Summary Introduction
To explain:
The calculation of the age of fossils without using absolute or relative dating techniques.
Introduction:
The age of fossils can be determined easily by the absolute or dating technique method. Various other methods can also be used for the calculation of the age of fossils. Radioactive decay is a technique used to identify the age of fossils.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?
Chapter 13 Solutions
BIOLOGY THE ESSENTIALS CONNECT ONLY
Ch. 13.1 - What is the geologic timescale?Ch. 13.1 - What types of information provide the clues that...Ch. 13.2 - Why is the fossil record useful, even if it doesnt...Ch. 13.2 - Distinguish between relative and absolute dating...Ch. 13.2 - How does radiometric dating work?Ch. 13.3 - Prob. 1MCCh. 13.3 - Prob. 2MCCh. 13.4 - Prob. 1MCCh. 13.4 - Prob. 2MCCh. 13.4 - Prob. 3MC
Ch. 13.5 - How does the study of embryonic development reveal...Ch. 13.5 - Prob. 2MCCh. 13.6 - How does analysis of DNA and proteins support...Ch. 13.6 - Prob. 2MCCh. 13 - Why is the fossil record incomplete? a. Because...Ch. 13 - Prob. 2MCQCh. 13 - Prob. 3MCQCh. 13 - The study of biogeography is most concerned with...Ch. 13 - Octopuses and cuttlefish are mollusks that have a...Ch. 13 - Ground beetles have useless hindwings. In related...Ch. 13 - Scorpions occupy every continent except...Ch. 13 - Prob. 8MCQCh. 13 - Prob. 9MCQCh. 13 - Which of the following would be most useful for...Ch. 13 - Prob. 1WIOCh. 13 - Prob. 2WIOCh. 13 - Why are transitional fossils especially useful for...Ch. 13 - Prob. 4WIOCh. 13 - Index fossils represent organisms that were...Ch. 13 - Prob. 6WIOCh. 13 - Prob. 7WIOCh. 13 - How did the discovery of Wallaces line demonstrate...Ch. 13 - Why is it important for evolutionary biologists to...Ch. 13 - Suppose that plants in the San Francisco Bay area...Ch. 13 - Many species look similar as embryos. What causes...Ch. 13 - Give examples of how the field of evolutionary...Ch. 13 - Prob. 13WIOCh. 13 - Prob. 14WIOCh. 13 - Prob. 15WIOCh. 13 - Prob. 16WIOCh. 13 - Genetic anthropology combines the study of DNA...Ch. 13 - Review Burning Question 13.13, which explains why...Ch. 13 - Review the Survey the Landscape figure in the...Ch. 13 - Write a phrase to connect fossils and biogeography...Ch. 13 - Add the following terms to this concept map:...Ch. 13 - Provide an example of ach line of evidence for...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Developmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forwardBiology How would you make 1 L of 0.5X TBE buffer using5X TBE buffer solution and distilled water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning


Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Fossil: The Language & History of Paleontology; Author: Alliterative;https://www.youtube.com/watch?v=x9yNwRBlKtU;License: Standard youtube license