Biology (MindTap Course List)
10th Edition
ISBN: 9781285423586
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 7TYU
Which of the following is/are not found in a bacterial mRNA molecule? (a) stop codon (b) upstream leader sequences (c) downstream trailing sequences (d) start codon (e) promoter sequences
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
During Codon recognition
(a) the ribosome moves towards the 3’ end of the mRNA (b) a tautomeric shift occurs (c) a peptide bond forms (d) anticodon and codon pairing occurs (e) all of the above
The portion of the mRNA that is removed during splicing is
(a) an inverted repeat (b) the promoter (c) the poly A tail (d) the intron (e) the exon
The ribosome is needed for translation of mRNA
(a) because it has the enzyme for adding amino acids to the 5’ end of a tRNA (b) because the ribosomal RNA contains the codon which determines the sequence of amino acids in a protein (c) because it positions tRNA and mRNA so that correct pairing of codon and anti-codon can occur (d) because it has an enzyme that removes introns from mRNA (e) all of the above
Chapter 13 Solutions
Biology (MindTap Course List)
Ch. 13.1 - Summarize the early evidence indicating that some...Ch. 13.1 - Describe how Beadle and Tatums experiments...Ch. 13.1 - Prob. 1CCh. 13.1 - How did the work of each of the following...Ch. 13.2 - Outline the flow of genetic information in cells,...Ch. 13.2 - Compare the structures of DNA and RNA.Ch. 13.2 - Explain why the genetic code is said to be...Ch. 13.2 - VISUALIZE Sketch a simple flow diagram that shows...Ch. 13.2 - Prob. 2CCh. 13.3 - Compare the processes of transcription and DNA...
Ch. 13.3 - Compare bacterial and eukaryotic mRNAs, and...Ch. 13.3 - In what ways are DNA polymerase and RNA polymerase...Ch. 13.3 - A certain template DNA strand has the following...Ch. 13.3 - What features do mature eukaryotic mRNA molecules...Ch. 13.4 - Identify the features of tRNA that are important...Ch. 13.4 - Explain how ribosomes function in polypeptide...Ch. 13.4 - Prob. 10LOCh. 13.4 - Prob. 11LOCh. 13.4 - What are ribosomes made of? Do ribosomes carry...Ch. 13.4 - What happens in each stage of polypeptide...Ch. 13.4 - A certain mRNA strand has the following nucleotide...Ch. 13.5 - Give examples of the different classes of...Ch. 13.5 - What are the main types of mutations?Ch. 13.5 - Prob. 2CCh. 13.6 - Briefly discuss RNA interference.Ch. 13.6 - Prob. 14LOCh. 13.6 - Prob. 15LOCh. 13.6 - Prob. 1CCh. 13.6 - Prob. 2CCh. 13.6 - Prob. 3CCh. 13 - Prob. 1TYUCh. 13 - What is the correct order of information flow in...Ch. 13 - During transcription, how many RNA nucleotide...Ch. 13 - The genetic code is defined as a series of...Ch. 13 - RNA differs from DNA in that the base...Ch. 13 - Prob. 6TYUCh. 13 - Which of the following is/are not found in a...Ch. 13 - Which of the following is/are typically removed...Ch. 13 - Prob. 9TYUCh. 13 - Suppose you mix the following components of...Ch. 13 - Prob. 11TYUCh. 13 - Prob. 12TYUCh. 13 - Compare and contrast the formation of mRNA in...Ch. 13 - Explain to a friend the experimental strategy that...Ch. 13 - Biologists hypothesize that transposons eventually...Ch. 13 - Prob. 16TYUCh. 13 - Prob. 17TYUCh. 13 - Prob. 18TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the precedingarrow_forwardThe code is also said to be degenerate/ redundant, which means that (a) different codons can encode the same amino acid (b) the genetic code can mutate (c) the genetic code is read as a triplet (d) the genetic code is overlapping (e ) all of the abovearrow_forwardA synthetic mRNA was made by linking together 5 G-A 3' dinucleotides. Which amino acid(s) would be incorporated into protein in an in vitro translation of that mRNA?Question 30 options: A) only Glycine (Gly) B) only Glutamate (Glu) C) only Arginine (Arg) D) only Glutamate (Glu) and Arginine (Arg) E) Glycine (Gly), Glutamate (Glu), and Arginine (Arg)arrow_forward
- Sickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…arrow_forwardOrder+the+following+of+protein+sentesis+sequence+from+earliest: (a)tRNA molecule bring specific amino acids to he mRNA molecule. b)mRNA nucleotides join with exposed DNA bases and form a molecule of mRNA.(c)The two stands of a DNA molecule separate. (d)Peptide bonds form between the amino acids. (e)the mRNA molecule leave the nucleus. (f) a ribosome attached to the mRNA molecule.arrow_forwardThe ribosome is needed for translation of mRNA (a) because it has the enzyme that forms peptide bonds between amino acids (b) because the ribosomal RNA contains the codon which determine the sequence of amino acids in a protein (c) because it contains the enzyme that links the amino acids and tRNA (d) because it has enzyme that removes introns from mRNA (e) all of the abovearrow_forward
- Which component is not directly involved in translation?(A) GTP(B) DNA(C) tRNA(D) ribosomesarrow_forwardWhat is the correct order of information flow in bacterial and eukaryotic cells? (a) DNA →mRNA →protein (b) protein → mRNA → DNA (c) DNA →protein→mRNA (d) protein →DNA → mRNA (e) mRNA → protein → DNAarrow_forwardWhich of the following is not true of RNA processing?(A) Exons are cut out before mRNA leaves the nucleus.(B) Nucleotides may be added at both ends of the RNA.(C) Ribozymes may function in RNA splicing.(D) RNA splicing can be catalyzed by spliceosomes.arrow_forward
- The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1) Find the sequence of the MRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the Tis substituted with A (count from 5' end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!arrow_forwardWhich statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protienarrow_forwardAn mRNA has a sequence 3'-AAAUUACUCGAAAUUGCGUGUAGU5'. a) What would be the DNA, t-RNA and amino acid sequence of the above-mentioned mRNA sequence. (Do not forget to read the sequence from 5' to 3' direction while decoding the transcript) (5)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
genetic recombination strategies of bacteria CONJUGATION, TRANSDUCTION AND TRANSFORMATION; Author: Scientist Cindy;https://www.youtube.com/watch?v=_Va8FZJEl9A;License: Standard youtube license