
HUMAN ANATOMY PACKAGE 2015
15th Edition
ISBN: 9781323100561
Author: Martini
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13, Problem 6RC
Summary Introduction
To review:
The function of the blood–brain barrier (BBB).
Introduction:
The BBB is a very selective barrier membrane, which creates a barrier between the blood and the extracellular fluid present in the central nervous system (CNS). This barrier is formed by the endothelial cells of the brain. It allows the movement of water, certain gases, and lipid soluble solute across the membrane by the means of passive and selective transport. Astrocytes, one of the neuroglia helps in the maintenance of the BBB.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 13 Solutions
HUMAN ANATOMY PACKAGE 2015
Ch. 13 - Match each numbered item with the most closely...Ch. 13 - Prob. 2RFTCh. 13 - Prob. 3RFTCh. 13 - Match each numbered item with the most closely...Ch. 13 - Match each numbered item with the most closely...Ch. 13 - Match each numbered item with the most closely...Ch. 13 - Prob. 7RFTCh. 13 - Prob. 8RFTCh. 13 - Prob. 9RFTCh. 13 - Prob. 10RFT
Ch. 13 - 11. Which of the following is not a function of...Ch. 13 - Neuroglia found surrounding the cell bodies of...Ch. 13 - The most important function of the cell body of a...Ch. 13 - Fill in the blanks below with the proper...Ch. 13 - 15. Axons terminate in a series of fine extensions...Ch. 13 - Prob. 15RFTCh. 13 - Prob. 1RCCh. 13 - Prob. 2RCCh. 13 - 3. Developmental problems in the growth and...Ch. 13 - Prob. 4RCCh. 13 - How does exteroceptor activity differ from...Ch. 13 - Prob. 6RCCh. 13 - Prob. 7RCCh. 13 - Prob. 8RCCh. 13 - Prob. 9RCCh. 13 - Prob. 10RCCh. 13 - Prob. 1CTCh. 13 - Prob. 2CTCh. 13 - Prob. 3CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning