Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12.3, Problem 1COMQ
Which RNA polymerase in eukaryotes is responsible for the transcription of genes that encode proteins?
a. RNA polymerase I
b. RNA polymerase II
c. RNA polymerase III
d. All of the above
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Chapter 12 Solutions
Genetics: Analysis and Principles
Ch. 12.1 - 1. Which of the following base sequences is used...Ch. 12.1 - Prob. 2COMQCh. 12.2 - With regard to a promoter, a transcriptional start...Ch. 12.2 - Prob. 2COMQCh. 12.2 - 3. Sigma factor is needed during which stage(s) of...Ch. 12.2 - A uracil-rich sequence occurs at the end of the...Ch. 12.3 - Which RNA polymerase in eukaryotes is responsible...Ch. 12.3 - Prob. 2COMQCh. 12.3 - Prob. 3COMQCh. 12.3 - Prob. 4COMQ
Ch. 12.4 - Which of the following are examples of RNA...Ch. 12.4 - A ribozyme is a. a complex between RNA and a...Ch. 12.4 - Prob. 3COMQCh. 12.4 - Prob. 4COMQCh. 12.5 - 1. Which of the following is not a key difference...Ch. 12 - Prob. 1CONQCh. 12 - Prob. 2CONQCh. 12 - Prob. 3CONQCh. 12 - Prob. 4CONQCh. 12 - 5. Mutations in bacterial promoters may increase...Ch. 12 - Prob. 6CONQCh. 12 - 7. In Chapter 9, we considered the dimensions of...Ch. 12 - 8. A mutation within a gene sequence changes the...Ch. 12 - Prob. 9CONQCh. 12 - At the molecular level, describe how factor...Ch. 12 - Prob. 11CONQCh. 12 - What is the complementarity rule that governs the...Ch. 12 - 13. Describe the movement of the open complex...Ch. 12 - 14. Describe what happens to the chemical bonding...Ch. 12 - Prob. 15CONQCh. 12 - Prob. 16CONQCh. 12 - Prob. 17CONQCh. 12 - Mutations that occur at the end of a gene may...Ch. 12 - If the following RNA polymerases were missing from...Ch. 12 - 20. What sequence elements are found within the...Ch. 12 - 21. For each of the following transcription...Ch. 12 - 22. Describe the allosteric and torpedo models for...Ch. 12 - Which eukaryotic transcription factor(s) shown in...Ch. 12 - 24. The initiation phase of eukaryotic...Ch. 12 - A eukaryotic protein-encoding gene contains two...Ch. 12 - 26. Describe the processing events that occur...Ch. 12 - Prob. 27CONQCh. 12 - Prob. 28CONQCh. 12 - Prob. 29CONQCh. 12 - Prob. 30CONQCh. 12 - 31. In eukaryotes, what types of modifications...Ch. 12 - Prob. 32CONQCh. 12 - Prob. 33CONQCh. 12 - 34. Figure 12.21 shows the products of alternative...Ch. 12 - 35. The processing of ribosomal RNA in eukaryotes...Ch. 12 - Prob. 36CONQCh. 12 - Prob. 37CONQCh. 12 - After the intron (which is in a lariat...Ch. 12 - Prob. 1EQCh. 12 - 2. Chapter 21 describes a technique known as...Ch. 12 - Prob. 3EQCh. 12 - As described in Chapter 21 and in experimental...Ch. 12 - Prob. 5EQCh. 12 - Prob. 6EQCh. 12 - 1. Based on your knowledge of introns and pre-mRNA...Ch. 12 - Discuss the types of RNA transcripts and the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY