CONNECT FOR SEELEY'S ANAT & PHYS
12th Edition
ISBN: 9781264052325
Author: VanPutte
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Question
Chapter 12.2, Problem 9AYP
Summary Introduction
To determine:
The differences between a stretch reflex and a Golgi tendon reflex and the sensory receptors for each.
Introduction:
An automatic response to a stimulus without conscious thought is called a reflex. Reflexes can vary in their complexity. Reflexes are integrated within the spinal cord or the brain. Some reflexes involve excitatory neurons, while some involve inhibitory neurons based on the stimuli.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 12 Solutions
CONNECT FOR SEELEY'S ANAT & PHYS
Ch. 12.1 - Prob. 1AYPCh. 12.1 - Name the meninges surrounding the spinal cord....Ch. 12.1 - What is the thecal sac? What two structures hold...Ch. 12.1 - Describe the arrangement of gray arid white matter...Ch. 12.1 - Where are the cell bodies of somatic motor and...Ch. 12.1 - What kinds of neurons are in the dorsal roots, in...Ch. 12.2 - Prob. 7AYPCh. 12.2 - Describe the operation of a gamma motor neuron.Ch. 12.2 - Prob. 9AYPCh. 12.2 - Prob. 10AYP
Ch. 12.2 - Prob. 11AYPCh. 12.3 - Prob. 12AYPCh. 12.3 - What is a dermatome? Why are dermatomes clinically...Ch. 12.3 - Prob. 14AYPCh. 12.3 - Describe the distribution of the ventral rami of...Ch. 12.3 - Prob. 16AYPCh. 12.3 - Prob. 17AYPCh. 12.3 - Prob. 18AYPCh. 12.3 - Name the five major nerves that emerge from the...Ch. 12.3 - Name the four major nerves that arise from the...Ch. 12.3 - Prob. 21AYPCh. 12.3 - Describe the structures innervated by the...Ch. 12.3 - Prob. 23AYPCh. 12 - Prob. 1RACCh. 12 - The structure that anchors the inferior end of the...Ch. 12 - Prob. 3RACCh. 12 - Given these components of a reflex arc: (1)...Ch. 12 - Prob. 5RACCh. 12 - Several of the events that occur between the time...Ch. 12 - Prob. 7RACCh. 12 - Prob. 8RACCh. 12 - Damage to the dorsal ramus of a spinal nerve...Ch. 12 - Prob. 10RACCh. 12 - A dermatome Is the area of skin supplied by a pair...Ch. 12 - Prob. 12RACCh. 12 - The skin on the posterior surface of the hand is...Ch. 12 - The scatic nerve is actually two nerves combined...Ch. 12 - Prob. 15RACCh. 12 - Describe how stimulation of a neuron that has its...Ch. 12 - Prob. 2CTCh. 12 - Prob. 3CTCh. 12 - Prob. 4CTCh. 12 - Prob. 5CTCh. 12 - Prob. 6CTCh. 12 - Prob. 7CT
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning