Connect with LearnSmart for Hoefnagels: Biology: The Essentials
3rd Edition
ISBN: 9781260140712
Author: MariÂlle Hoefnagels
Publisher: Mcgraw-hill Higher Education (us)
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 1.2, Problem 3MC
Summary Introduction
To determine:
The four main groups of eukaryotes.
Introduction:
In taxonomic classification, the third domain is called Eukarya that contains all eukaryotic organisms. Eukaryotes may contain unicellular or multicellular organisms and the cell possesses a nucleus.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 1 Solutions
Connect with LearnSmart for Hoefnagels: Biology: The Essentials
Ch. 1.1 - Prob. 1MCCh. 1.1 - The bacteria in figure 1.8 reproduce asexually,...Ch. 1.2 - If the human and kangaroo in figure 1.9 switched...Ch. 1.2 - Prob. 2MCCh. 1.2 - Prob. 3MCCh. 1.3 - Identify the elements of the experiment summarized...Ch. 1.3 - What is a statistically significant result?Ch. 1.3 - Prob. 3MCCh. 1.3 - What are some limitations of scientific inquiry?Ch. 1.3 - Prob. 5MC
Ch. 1 - Which of the following is smaller than an...Ch. 1 - All of the following are characteristics of life...Ch. 1 - The concentration of salts in blood remains...Ch. 1 - Prob. 4MCQCh. 1 - Prob. 5MCQCh. 1 - What is the correct way to write the scientific...Ch. 1 - Prob. 7MCQCh. 1 - A scientist has just observed a new phenomenon and...Ch. 1 - Prob. 9MCQCh. 1 - Prob. 10MCQCh. 1 - Prob. 1WIOCh. 1 - Prob. 2WIOCh. 1 - Prob. 3WIOCh. 1 - Prob. 4WIOCh. 1 - Prob. 5WIOCh. 1 - Think of an analogy that will help you remember...Ch. 1 - Other than the brownie example given in the text,...Ch. 1 - Explain why populations of organisms are typically...Ch. 1 - How are the members of the three domains similar?...Ch. 1 - Give two examples of questions that cannot be...Ch. 1 - If you dissect and label the parts of an...Ch. 1 - List each step of the scientific method and...Ch. 1 - Prob. 13WIOCh. 1 - Review Why We Care 1.1, which describes...Ch. 1 - Prob. 1PITCh. 1 - What is the relationship between natural selection...Ch. 1 - Prob. 3PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBasic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning


Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage
The Cell Cycle and its Regulation; Author: Professor Dave Explains;https://www.youtube.com/watch?v=eqJqhA8HSJ0;License: Standard YouTube License, CC-BY
Cell Division - Mitosis and Meiosis - GCSE Biology (9-1); Author: Mr Exham Biology;https://www.youtube.com/watch?v=w7vp_uRA8kw;License: Standard YouTube License, CC-BY