EBK CONCEPTS OF GENETICS
12th Edition
ISBN: 9780134818979
Author: Killian
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 2PDQ
CONCEPT QUESTION Review the Chapter Concepts list on p. 263. These all relate to how DNA is organized in viral, bacterial, and eukaryote chromosomes. Write a short essay that contrasts the major differences between the organization of DNA in viruses and bacteria versus eukaryotes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
35. M Heinz Shuster collected the following data on the base composition
Move
ANALYSIS
ribgrass mosaic virus (H. Shuster, in The Nucleic Acids: Chemistry and Biology,
vol. 3, E. Chargaff and J. N. Davidson, Eds. New York: Academic Press, 1955). On
the basis of this information, is the hereditary information of the ribgrass
mosaic virus RNA or DNA? Is it likely to be single stranded or double stranded?
Percentage
A
T
U
Ribgrass
29.3
25.8
18.0
0.0
27.0
mosaic
virus
Leibniz Institute for Age Research, Fritz
Lipmann-Institute.
Ribgrass mosaic virus.
In bacteriophages and bacteria, the DNA is almost always organized into circular (closed loops) chromosomes. Phage l is an exception, maintaining its DNA in a linear chromosome within the viral particle. However, as soon as this DNA is injected into a host cell, it circularizes before replication begins. What advantage exists in replicating circular DNA molecules compared to linear molecules, characteristic of eukaryotic chromosomes?
Given that viruses must be cultivated to make vaccines against viral diseases, discuss the advantages and disadvantages that might occur with each approach (embryonated egg versus cell culture) to growing animal viruses.
Chapter 12 Solutions
EBK CONCEPTS OF GENETICS
Ch. 12 - In bacteriophages and bacteria, the DNA is almost...Ch. 12 - After salivary gland cells from Drosophila are...Ch. 12 - If a human nucleus is 10 m in diameter, and it...Ch. 12 - Roberts syndrome is a rare inherited disorder...Ch. 12 - Prob. 2CSCh. 12 - Roberts syndrome is a rare inherited disorder...Ch. 12 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 12 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 12 - Contrast the size of the single chromosome in...Ch. 12 - Describe the structure of giant polytene...
Ch. 12 - What genetic process is occurring in a puff of a...Ch. 12 - During what genetic process are lampbrush...Ch. 12 - Why might we predict that the organization of...Ch. 12 - Describe the sequence of research findings that...Ch. 12 - Describe the molecular composition and arrangement...Ch. 12 - Describe the transitions that occur as nucleosomes...Ch. 12 - Provide a comprehensive definition of...Ch. 12 - Mammals contain a diploid genome consisting of at...Ch. 12 - Assume that a viral DNA molecule is a 50-m-long...Ch. 12 - How many base pairs are in a molecule of phage T2...Ch. 12 - Examples of histone modifications are acetylation...Ch. 12 - Contrast the structure of SINE and LINE DNA...Ch. 12 - Variable number tandem repeats (VNTRs) are...Ch. 12 - It has been shown that infectious agents such as...Ch. 12 - Cancer can be defined as an abnormal proliferation...Ch. 12 - In a study of Drosophila, two normally active...Ch. 12 - Prob. 21ESPCh. 12 - An article entitled Nucleosome Positioning at the...Ch. 12 - Prob. 23ESPCh. 12 - Following is a diagram of the general structure of...Ch. 12 - Microsatellites are currently exploited as markers...Ch. 12 - At the end of the short arm of human chromosome 16...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- To test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…arrow_forwardThis is a three part question: Figure B in Box 4.1 illustrates the results of the Meselson-Stahl experiment after a single cycle of replication in 14N. (a) Explain the results they observed after two rounds of replication in 14N medium. (b) Draw out the expected results if a third round of replication were allowed in 14N medium. (c) Two other models for template-directed replication were considered as alternatives to semi-conservative replication. One of these was conservative replication, in which the parental strands were unpaired, replicated, then reannealed such that the parental strands stayed together and the newly synthesized strands were together. The second model was dispersive replication, in which one strand was used as the template for polymerization, then the polymerase switched to using the other strand as the template, and subsequently switched back and forth between the two strands until bother were fully replicated. Each of these models is ruled out by one of your…arrow_forwardA major difference between prokaryotes and eukaryotes is the presence of a nucleus. What advantages and disadvantages may occur with having a cell’s genome packaged in a nucleus?arrow_forward
- Explain TWO (2) differences between two commonly used ligases; F. coli DNA ligase and T4 DNA ligase.arrow_forwardTo study the interaction between viral proteins and Z-DNA, how could Z-DNA-forming DNA be synthesized in the lab?arrow_forwardtrue or false 1.) The unique stem-loop structures of the transfer RNA helps the RNA perform its function of joining ribosomal proteins to form the sites for protein synthesis. 2.) DNA molecules can perform their function in replication and transcription as long as the 2 strands remain intact and not separated. 3.) Histone proteins are able to associate with DNA segments because of the anionic nature of the amino acids arg and lys. 4.) The long solenoid structure of the chromatin material binds to a protein scaffold and folds further to form the chromatin/chromosome structure. 5.) Primary amines and keto groups of the nitrogen bases are involved in base-pairing in double stranded DNA.arrow_forward
- 72) Herpes simplex virus and cytomegalovirus are both in the herpes virus family, but of the two, only herpes simplex virus is susceptible to acyclovir. The reason for the differential sensitivity to acyclovir relates to which of the following characteristics of the drug? (A) It causes termination of elongation DNA chains (B) It inhibits herpesviral DNA-dependent DNA polymerase (C) It inhibits herpesviral RNA-dependent RNA polymerase (D) It is phosphorylated by herpesvirus-encoded thymidine kinases (E) It is phosphorylated only by cellular thymidine kinasesarrow_forward5.64 x 10^6 base pairs Short questionsarrow_forwardName a nucleoside analog. Explain how that nucleoside analog works. Which viruses are effectively treated by that nucleoside analog?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY