
Introduction:
Antibiotics are sometimes naturally formed chemicals which are released by soil

Answer to Problem 1MCQ
Correct answer:
A compound synthesized by bacteria or fungi that destroys or inhibits the growth of other microbes is an antibiotic. Therefore, option (b) is correct.
Option (b) is given as “antibiotic”.
Explanation of Solution
Justify reasons for the correct statement:
Antibiotics can be produced only by a living organism such as bacteria. Antibiotics can be generated either alone or by different groups of microorganisms such as bacteria, actinomycetes,and fungi. More than thirty antibiotics have been isolated from those groups. Microbes that can produce antibiotics are useful for the prevention and treatment of many diseases including bacterial and fungal disease. For example, penicillin and tetracycline.
Hence, option (b) is correct.
Justify reasons for the incorrect statements:
Option (a) is given as “synthetic drug”.
Drugs that are synthesized in the laboratory by mimic the action of natural compounds by
Option (c) is given as “interferon”.
Interferon, a human-based compound that is a glycoprotein. It is produced by leukocytes and fibroblasts in response to many immune responses. Hence, it is a wrong answer.
Option (d) is given as “competitive inhibitor”.
A form of enzyme inhibition that contains the binding of an inhibitor that preventsthe binding of the target molecule of the enzyme is termed as a competitive inhibitor. Hence, it is a wrong answer.
Hence, options (a),(c), and(d) are incorrect.
Antibiotics eradicate the bacteria that are susceptible to departing from the resistant
Want to see more full solutions like this?
Chapter 12 Solutions
Microbiology: A Systems Approach
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
- Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:CengageMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning


