GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
6th Edition
ISBN: 9781260239775
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 12, Problem 12CONQ
What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence:
5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′
What is the sequence of the template and coding strands of the DNA that encodes this RNA? On which side (5′ or 3′) of the template strand is the promoter located?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What is the opening indicated by the pointer? (leaf x.s.)
stomate
guard cell
lenticel
intercellular space
none of these
Identify the indicated tissue? (stem x.s.)
parenchyma
collenchyma
sclerenchyma
○ xylem
○ phloem
none of these
Where did this structure originate from? (Salix branch root)
epidermis
cortex
endodermis
pericycle
vascular cylinder
Chapter 12 Solutions
GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
Ch. 12.1 - 1. Which of the following base sequences is used...Ch. 12.1 - Prob. 2COMQCh. 12.2 - With regard to a promoter, a transcriptional start...Ch. 12.2 - Prob. 2COMQCh. 12.2 - 3. Sigma factor is needed during which stage(s) of...Ch. 12.2 - A uracil-rich sequence occurs at the end of the...Ch. 12.3 - Which RNA polymerase in eukaryotes is responsible...Ch. 12.3 - Prob. 2COMQCh. 12.3 - Prob. 3COMQCh. 12.3 - Prob. 4COMQ
Ch. 12.4 - Which of the following are examples of RNA...Ch. 12.4 - A ribozyme is a. a complex between RNA and a...Ch. 12.4 - Prob. 3COMQCh. 12.4 - Prob. 4COMQCh. 12.5 - 1. Which of the following is not a key difference...Ch. 12 - Prob. 1CONQCh. 12 - Prob. 2CONQCh. 12 - Prob. 3CONQCh. 12 - Prob. 4CONQCh. 12 - 5. Mutations in bacterial promoters may increase...Ch. 12 - Prob. 6CONQCh. 12 - 7. In Chapter 9, we considered the dimensions of...Ch. 12 - 8. A mutation within a gene sequence changes the...Ch. 12 - Prob. 9CONQCh. 12 - At the molecular level, describe how factor...Ch. 12 - Prob. 11CONQCh. 12 - What is the complementarity rule that governs the...Ch. 12 - 13. Describe the movement of the open complex...Ch. 12 - 14. Describe what happens to the chemical bonding...Ch. 12 - Prob. 15CONQCh. 12 - Prob. 16CONQCh. 12 - Prob. 17CONQCh. 12 - Mutations that occur at the end of a gene may...Ch. 12 - If the following RNA polymerases were missing from...Ch. 12 - 20. What sequence elements are found within the...Ch. 12 - 21. For each of the following transcription...Ch. 12 - 22. Describe the allosteric and torpedo models for...Ch. 12 - Which eukaryotic transcription factor(s) shown in...Ch. 12 - 24. The initiation phase of eukaryotic...Ch. 12 - A eukaryotic protein-encoding gene contains two...Ch. 12 - 26. Describe the processing events that occur...Ch. 12 - Prob. 27CONQCh. 12 - Prob. 28CONQCh. 12 - Prob. 29CONQCh. 12 - Prob. 30CONQCh. 12 - 31. In eukaryotes, what types of modifications...Ch. 12 - Prob. 32CONQCh. 12 - Prob. 33CONQCh. 12 - 34. Figure 12.21 shows the products of alternative...Ch. 12 - 35. The processing of ribosomal RNA in eukaryotes...Ch. 12 - Prob. 36CONQCh. 12 - Prob. 37CONQCh. 12 - After the intron (which is in a lariat...Ch. 12 - Prob. 1EQCh. 12 - 2. Chapter 21 describes a technique known as...Ch. 12 - Prob. 3EQCh. 12 - As described in Chapter 21 and in experimental...Ch. 12 - Prob. 5EQCh. 12 - Prob. 6EQCh. 12 - 1. Based on your knowledge of introns and pre-mRNA...Ch. 12 - Discuss the types of RNA transcripts and the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Identify the indicated tissue. (Tilia stem x.s.) parenchyma collenchyma sclerenchyma xylem phloem none of thesearrow_forwardIdentify the indicated structure. (Cucurbita stem l.s.) pit lenticel stomate tendril none of thesearrow_forwardIdentify the specific cell? (Zebrina leaf peel) vessel element sieve element companion cell tracheid guard cell subsidiary cell none of thesearrow_forward
- What type of cells flank the opening on either side? (leaf x.s.) vessel elements sieve elements companion cells tracheids guard cells none of thesearrow_forwardWhat specific cell is indicated. (Cucurbita stem I.s.) vessel element sieve element O companion cell tracheid guard cell none of thesearrow_forwardWhat specific cell is indicated? (Aristolochia stem x.s.) vessel element sieve element ○ companion cell O O O O O tracheid O guard cell none of thesearrow_forward
- Identify the tissue. parenchyma collenchyma sclerenchyma ○ xylem O phloem O none of thesearrow_forwardPlease answer q3arrow_forwardRespond to the following in a minimum of 175 words: How might CRISPR-Cas 9 be used in research or, eventually, therapeutically in patients? What are some potential ethical issues associated with using this technology? Do the advantages of using this technology outweigh the disadvantages (or vice versa)? Explain your position.arrow_forward
- You are studying the effect of directional selection on body height in three populations (graphs a, b, and c below). (a) What is the selection differential? Show your calculation. (2 pts) (b) Which population has the highest narrow sense heritability for height? Explain your answer. (2 pts) (c) If you examined the offspring in the next generation in each population, which population would have the highest mean height? Why? (2 pts) (a) Midoffspring height (average height of offspring) Short Short Short Short (c) Short (b) Short Tall Short Tall Short Short Tall Midparent height (average height of Mean of population = 65 inches Mean of breading parents = 70 inches Mean of population = 65 inches Mean of breading parents = 70 inches Mean of population = 65 inches Mean of breading parents = 70 inchesarrow_forwardP You are studying a population of 100 flowers that has two alleles at a locus for flower color, blue (B) and green (G). There are 15 individuals with the BB genotype, 70 individuals with the BG genotype, and 15 individuals with the GG genotype. (a) What are the allele frequencies of B and G in the starting population? Show your calculations. (2 pts) (b) Is this population in Hardy-Weinberg equilibrium? Show your calculations. (3 pts) 12pt v Paragraph BIU UA AV & VT2V f CO Varrow_forwardIn a natural population of outbreeding plants, the variance of the total number of seeds per plant is 16. From the natural population, 20 plants are taken into the laboratory and developed into separate true-breeding lines by self- fertilization-with selection for high, low, or medium number of seeds-for 10 generations. The average variance in the tenth generation in each of the 20 sets is about equal and averages 5.8 across all the sets. Estimate the broad-sense heritability for seed number in this population. (4 pts) 12pt v Paragraph BIUA V V T² v B ① O wordsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license