
Biology: Concepts and Investigations
5th Edition
ISBN: 9781260542202
Author: Marielle Hoefnagels
Publisher: Mcgraw-hill Higher Education (us)
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 11.4, Problem 3MC
Summary Introduction
To describe:
The term gene therapy.
Concept introduction:
The application of medical technology involving the correction of defected genes that affect the humans and generates the genetic disorders by inserting the genes is called “gene therapy”. The functional genes replace the defected genes and this process does not involve treatment with the use of medications.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 11 Solutions
Biology: Concepts and Investigations
Ch. 11.1 - Prob. 1MCCh. 11.1 - Prob. 2MCCh. 11.2 - What are some uses for transgenic organisms?Ch. 11.2 - Prob. 2MCCh. 11.2 - Prob. 3MCCh. 11.2 - What is the function of the 98.5% of the human...Ch. 11.2 - How does PCR work, and why is it useful?Ch. 11.2 - Prob. 6MCCh. 11.2 - Why do investigators sometimes analyze...Ch. 11.3 - Prob. 1MC
Ch. 11.3 - Prob. 2MCCh. 11.3 - Summarize the steps scientists use to clone an...Ch. 11.3 - Prob. 4MCCh. 11.4 - Prob. 1MCCh. 11.4 - Prob. 2MCCh. 11.4 - Prob. 3MCCh. 11.4 - Prob. 4MCCh. 11.4 - What are some examples of ethical questions raised...Ch. 11.5 - Prob. 1MCCh. 11.5 - Prob. 2MCCh. 11 - If a restriction enzyme cuts between the G and the...Ch. 11 - Which of the following is not a reason that...Ch. 11 - Prob. 3MCQCh. 11 - Prob. 4MCQCh. 11 - Prob. 5MCQCh. 11 - Prob. 6MCQCh. 11 - Prob. 7MCQCh. 11 - What techniques might researchers use to create...Ch. 11 - Prob. 2WIOCh. 11 - Prob. 3WIOCh. 11 - Prob. 4WIOCh. 11 - Why are entire genomes not used for DNA profiling?Ch. 11 - In a 2013 investigation, researchers discovered...Ch. 11 - Unneeded genes in an adult animal cell are...Ch. 11 - Prob. 8WIOCh. 11 - Prob. 9WIOCh. 11 - Prob. 10WIOCh. 11 - If a cells genome is analogous to a cookbook and a...Ch. 11 - Prob. 12WIOCh. 11 - Review the Survey the Landscape figure in the...Ch. 11 - How does PCR relate to DNA profiling and...Ch. 11 - Add the terms restriction enzyme, plasmid, virus,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningCase Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:CengageHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningEssentials Health Info Management Principles/Prac...Health & NutritionISBN:9780357191651Author:BowiePublisher:Cengage

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Essentials Health Info Management Principles/Prac...
Health & Nutrition
ISBN:9780357191651
Author:Bowie
Publisher:Cengage
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY