EBK BROCK BIOLOGY OF MICROORGANISMS
15th Edition
ISBN: 8220103633352
Author: Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 1.13, Problem 3MQ
- List three reasons why rRNA genes are suitable for phylogenetic analyses.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Why is sequence alignment critical to phylogenetic analysis?
Explain how the different “-omics” involved with the three major parts of the central dogma can be used to study this new species. What are molecular techniques/tools (sequencers) that can be used to study each of these? How would you sequence the genome efficiently (i.e., lowest amount of time and money)?
What are three reasons that functional traits might notcorrespond with distinct phylogenetic groups as defined by16S ribosomal RNA gene sequences?
Chapter 1 Solutions
EBK BROCK BIOLOGY OF MICROORGANISMS
Ch. 1.1 - In what ways are microorganisms important to...Ch. 1.1 - Why are microbial cells useful for understanding...Ch. 1.1 - What is a microbial colony and how is one formed?Ch. 1.1 - What are bacterial colonies and how are they...Ch. 1.2 - What structures are universal to all types of...Ch. 1.2 - Prob. 2MQCh. 1.2 - What structures can be used to distinguish between...Ch. 1.2 - Prob. 1CRCh. 1.3 - How old is Earth and when did cells first appear...Ch. 1.3 - Prob. 2MQ
Ch. 1.3 - Why were cyanobacteria so important in the...Ch. 1.3 - Prob. 1CRCh. 1.4 - Prob. 1MQCh. 1.4 - Prob. 2MQCh. 1.4 - Prob. 3MQCh. 1.4 - Prob. 1CRCh. 1.5 - Define the terms magnification and resolution.Ch. 1.5 - Prob. 2MQCh. 1.5 - Prob. 1CRCh. 1.6 - Prob. 1MQCh. 1.6 - Prob. 2MQCh. 1.6 - How can cells be made to fluoresce?Ch. 1.6 - Prob. 1CRCh. 1.7 - Prob. 1MQCh. 1.7 - Prob. 2MQCh. 1.7 - Prob. 1CRCh. 1.8 - Prob. 1MQCh. 1.8 - Prob. 2MQCh. 1.8 - Prob. 1CRCh. 1.9 - Prob. 1MQCh. 1.9 - Prob. 2MQCh. 1.9 - Besides ending the controversy over spontaneous...Ch. 1.9 - Explain the principle behind the Pasteur flask in...Ch. 1.10 - How do Kochs postulates ensure that cause and...Ch. 1.10 - What advantages do solid media offer for the...Ch. 1.10 - Prob. 3MQCh. 1.10 - Prob. 1CRCh. 1.11 - What is meant by the term enrichment culture?Ch. 1.11 - Prob. 2MQCh. 1.11 - What were the major microbiological interests of...Ch. 1.12 - Describe the experiments that proved DNA was the...Ch. 1.12 - Why are microbial cells useful tools for basic...Ch. 1.12 - Describe the experiments that proved DNA to be the...Ch. 1.13 - What kinds of evidence support the three-domain...Ch. 1.13 - What is a phylogenetic tree?Ch. 1.13 - List three reasons why rRNA genes are suitable for...Ch. 1.13 - What insights led to the reconstruction of the...Ch. 1.14 - How are viruses different from Bacteria, Archaea,...Ch. 1.14 - What four bacterial phyla contain the most...Ch. 1.14 - Prob. 3MQCh. 1.14 - What features (or lack of features) can be used to...Ch. 1 - Pasteurs experiments on spontaneous generation...Ch. 1 - Describe the lines of proof Robert Koch used to...Ch. 1 - Imagine that all microorganisms suddenly...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the following four DNA sequences taken from the a homologous gene from four different organisms. The bases are in groups of 10 for ease of interpretation. ACTGCGAGGT ACTGCGAGTT ACTTCGAGTT GCCATGTCAС GCCGTGAGAC GCCATGTGAC AGTACTGACG Organism 1 Organism 2 Organism 3 Organism 4 GCATCAGGAТ GCACCAGGAT GCATCAGGAT ACGCAGAAAT AATTCTGAGA AGTACTGACA AGTTCTGAGA ACGCAGAAAT ATGCAGAAAT GCTGCGAGTT GCACCAGGAT GCCATGACÁC ACGCGAAAAT a. For each pair of organisms determine the genetic distance between them. The genetic distance is simply the percentage difference between the two genes. Since each sequence is 50 base bases long, the genetic distance will be 2x the number of base differences. For example, if two sequences are identical except for one base, the genetic distance is 2%. b. List the genetic distances in the table below for each pair of organisms. Organism 1 Organism 2 Organism 3 Organism 4 Organism 4 Organism 3 Organism 2 Organism 1 c. Draw a phylogenetic tree of these 4 organisms, in…arrow_forwardThere 27 sequences from 27 individuals belonging to an unidentified group of organisms. Eleven (11) sequences were mined from NCBI while the rest are unpublished sequences from Mindanao. Sequences labeled with "SSL" are from Agusan Marsh while sequences labeled with "CKL/CITLR" and "CWL" are from Camiguin Island and Dinagat Islands respectively. Finally, sequences labeled with "MSLA" are from Mt. Magdiwata. (a) What species is considered as the outgroup? (b) What genetic marker is utilized to generate the sequences? (c) Which specimen group is more closely related to "SSL"? CKL or MSLA? Justify your answer. (d) Based on the BLAST results, what possible species name can be assigned to the MSLA group?arrow_forwardA) What module can we use to run BLAST over the internet in Biopython: Bio.Blast.NCBIWWW Bio.Blast.NCBIXML WWW NCBIXML B) Which one of the following modules is not part of the Bio.Blast package in Biopython: NCBIStandalone FastaIO ParseBlastTable NCBIXML 3. Question 3 Using Biopython find out what species the following unknown DNA sequencearrow_forward
- Metagenomics has revolutionized our understanding of the microbial world by allowing the study of organisms that had been impossible to culture. Understanding the Lokiarchaeota required metagenomics analysis, which has also led to the identification of the eukaryotic signature genes in other environments. The terms below relate to genes and genetic analysis. Drag each term to the correct description. Drag and drop the terms on the left to match the description on the right. ▸ View Available Hint(s) Submit Homologous Monophyletic Metagenomics Orthologs Paralogs and that has a different function (this occurs through gene duplication) : the study of genetic material from an environmental sample Reset : a group of organisms in a phylogeny that have a common ancestor : a gene that is related in different species by being inherited from a common ancestor Help and that has the same function : a gene that is related in different species by being inherited from a common ancestor : a gene that…arrow_forwardExplain why the 16S rRNA gene sequence can reveal useful information about bacterial taxonomy that can be used to aid the rapid identification and genotyping of bacterial pathogens.arrow_forwardThere are 27 sequences from 27 individuals belonging to an unidentified group of organisms. Eleven (11) sequences were mined from NCBI while the rest are unpublished sequences from Mindanao. Sequences labeled with "SSL" are from Agusan Marsh while sequences labeled with "CKL/CITLR" and "CWL" are from Camiguin Island and Dinagat Islands respectively. Finally, sequences labeled with "MSLA" are from Mt. Magdiwata. From the nucleotide results and generated phylogenetic tree below: a) What group of organisms is represented by the phylogenetic tree? b) Identify the source (species) of each sequence. c) How many species are present in the generated tree? d) What species is considered as the outgroup? e) What genetic marker is utilized to generate the sequences? f) Which specimen group is more closely related to "SSL"? CKL or MSLA? Justify your answer h) Based on the results, what possible species name can be assigned to the MSLA group?arrow_forward
- Jackson Wang is a biologist working with the genetics of a thermophilic bacterium. He cloned a heat shock gene from the bacteria for further analysis. After cloning, he isolated the plasmid carrying his gene of interest for sequencing. Jackson finally received the nucleotide sequence of his gene. Explain in detail how he could verify whether the nucleotide sequence matches his gene of interest using the bioinformatics databases available.arrow_forwardPlease help.arrow_forwardIn 1995, Hamilton Smith, Craig Venter and co-workers published the first complete genome sequence of a self-sustaining organism, that of the bacterium Haemophilus influenzae. Analysis of the genome sequence revealed that the organism does not have a gene that could encode a telomerase enzyme. What is the potential evolutionary consequence of this? Explain your answer.arrow_forward
- Write and detail a complete all encompassing definition of a gene. Consider the morphology, physiology, ecological, behavioral, etc. aspects of the gene. Discuss each part of the gene listed in your definition. Is your definition of the gene as determined through complementation, recombination, and mutation for prokaryotes directly applicable to eucaryotes? Why or why not? What additional information must be taken into account?arrow_forwardWith regards to this sequence below please answer this quistions 1) What is the format of the sequence below and why 2) What do you understand by a query sequence 3) What is the sequence size of this sequence 4) What is the ID of the sequence and indicate the taxonomic rank of the ID ATGAAAAAACGAAAAGTGTTAATACCATTAATGGCATTGTCTACGATATTAGTTTCAAGCACAGGTAATT TAGAGGTGATTCAGGCAGAAGTTAAACAGGAGAACCGGTTATTAAATGAATCAGAATCAAGTTCCCAGGG GTTACTAGGATACTATTTTAGTGATTTGAATTTTCAAGCACCCATGGTGGTTACCTCTTCTACTACAGGG GATTTATCTATTCCTAGTTCTGATAGAAAATATTCCATCGGAAAACCAATATTTTCAATCTGCTATTTGG TCAGGATTTATCAAAGTTAAGAAGAGTGATGAATATACATTTGCTACTTCCGCTGATAATCATGTAACAA TGTGGGTAGATGACCAACAAGTGATTAATAAAGCTTCTAATTCTAACAAAATCAGATTAGAAAAAGGA AGATTATATCAAATAAAAATTCAATATCAACGAGAAAATCCTACTGAAAAAGGATTGGATTTCAAGTTGT ACTGGACCGATTCTCAAAATAAAAAAGAAGTGATTTCTAGTGATAACTTACAATTGCCAGAATTAAAACA AAAATCTTCGAACTCAAGAAAAAAGCGAAGTACAAGTGTGGACCTACGGTTCCAGACCGTGACAATGAT GGAATCCCTGATTCATTAGAGGTAGAAGGATATACGGTTGATGTCAAAAATAAAAGAACTTTTCTTTCAC…arrow_forwardBioinformatics is the science of using computational methods (specialized software) to decipher the biological meaning of information contained within an organismal system. If you have to identify a gene, for example from the fruit fly, that is of interest to you, and you would like to know whether the human genome contains a homolog (related gene) of the fruit fly gene, one tool you could use is a program called Group of answer choices RefSeq (species reference sequence) Excel BLAST (Basic Local Alignment Search Tool) GenBankarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mechanisms of Genetic Change or Evolution; Author: Scientist Cindy;https://www.youtube.com/watch?v=5FE8WvGzS4Q;License: Standard Youtube License