
ANATOMY+PHYSIOLOGY(LL)-W/CONNECT ACCESS
4th Edition
ISBN: 9781266364051
Author: McKinley
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 10.2, Problem 8WDYL
Summary Introduction
To describe:
The distribution of
Concept introduction:
Myofilaments are arranged in repeating units called sarcolemma. They are composed of thin and thick overlapping filaments and contains Z disc, I band, A band, H zone, and M line regions.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 10 Solutions
ANATOMY+PHYSIOLOGY(LL)-W/CONNECT ACCESS
Ch. 10.1 - What are the five major functions of skeletal...Ch. 10.1 - Prob. 2WDYLCh. 10.2 - Prob. 3WDYLCh. 10.2 - Draw and label a diagram of a sarcomere.Ch. 10.2 - Prob. 5WDYLCh. 10.2 - Prob. 6WDYLCh. 10.2 - Diagram and label the anatomic structures of a...Ch. 10.2 - Prob. 8WDYLCh. 10.3 - What triggers the binding of synaptic vesicles to...Ch. 10.3 - What two events are linked in the physiologic...
Ch. 10.3 - Prob. 11WDYLCh. 10.3 - Prob. 12WDYLCh. 10.3 - Describe the four processes that repeat in...Ch. 10.3 - What causes the release of the myosin head from...Ch. 10.3 - How do acetylcholinesterase and Ca2+ pumps...Ch. 10.4 - Prob. 16WDYLCh. 10.4 - What are the various means for making ATP...Ch. 10.4 - Prob. 18WDYLCh. 10.5 - Prob. 19WDYLCh. 10.5 - Prob. 20WDYLCh. 10.5 - Prob. 21WDYLCh. 10.6 - What events are occurring in a muscle that produce...Ch. 10.6 - What is recruitment? Explain its importance in the...Ch. 10.6 - Prob. 24WDYLCh. 10.7 - What is the function of skeletal muscle tone?Ch. 10.7 - When you flex your biceps brachii while doing...Ch. 10.7 - Prob. 27WDYLCh. 10.7 - How can muscle fatigue result from changes in each...Ch. 10.8 - Prob. 29WDYLCh. 10.8 - Prob. 30WDYLCh. 10.9 - What are three anatomic or physiologic differences...Ch. 10.10 - Prob. 32WDYLCh. 10.10 - Prob. 33WDYLCh. 10.10 - Prob. 34WDYLCh. 10.10 - What are the steps of smooth muscle contraction?Ch. 10.10 - What unique characteristics of smooth muscle allow...Ch. 10.10 - Prob. 37WDYLCh. 10.10 - Prob. 38WDYLCh. 10.10 - Prob. 39WDYLCh. 10 - Prob. 1DYKBCh. 10 - The physiologic event that takes place at the...Ch. 10 - In a skeletal muscle fiber, Ca2+ is released from...Ch. 10 - The bundle of dense regular connective tissue that...Ch. 10 - In excitation-contraction coupling, the transverse...Ch. 10 - During muscle contraction, the I band a. hides the...Ch. 10 - During a concentric contraction of a muscle fiber,...Ch. 10 - What event causes a troponin-tropomyosin complex...Ch. 10 - In sustained, moderate exercise, skeletal muscle...Ch. 10 - Skeletal muscle and cardiac muscle are similar in...Ch. 10 - Explain the structural relationship between a...Ch. 10 - Prob. 12DYKBCh. 10 - Prob. 13DYKBCh. 10 - Put the following skeletal muscle contraction...Ch. 10 - Explain the various means of providing ATP for...Ch. 10 - Explain why athletes who excel at short sprints...Ch. 10 - Explain why skeletal muscle generates the most...Ch. 10 - Prob. 18DYKBCh. 10 - Describe the response of smooth muscle to...Ch. 10 - Prob. 20DYKBCh. 10 - Prob. 1CALCh. 10 - One of the primary reasons that one individual is...Ch. 10 - Prob. 3CALCh. 10 - Rigor mortis occurs following death because a....Ch. 10 - Prob. 5CALCh. 10 - Prob. 1CSLCh. 10 - Describe the effect of the botulinum toxin, which...Ch. 10 - Smooth muscle is within the urinary bladder wall....
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxLifetime Physical Fitness & WellnessHealth & NutritionISBN:9781337677509Author:HOEGERPublisher:Cengage

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Lifetime Physical Fitness & Wellness
Health & Nutrition
ISBN:9781337677509
Author:HOEGER
Publisher:Cengage
GCSE PE - ANTAGONISTIC MUSCLE ACTION - Anatomy and Physiology (Skeletal and Muscular System - 1.5); Author: igpe_complete;https://www.youtube.com/watch?v=6hm_9jQRoO4;License: Standard Youtube License