HUMAN ANATOMY
6th Edition
ISBN: 9781260986037
Author: SALADIN
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 10.2, Problem 11BYGO
Summary Introduction
To analyze:
The growth of muscle without the involvement of the mitotic process.
Introduction:
The muscles are the soft tissues of the animals, that are made up of actin and myosin filaments. The muscles are involved in movement and locomotion in animals.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 10 Solutions
HUMAN ANATOMY
Ch. 10.1 - What general function of muscular tissue...Ch. 10.1 - Prob. 2BYGOCh. 10.1 - State five special properties of muscular tissue...Ch. 10.1 - What are the basic structural differences between...Ch. 10.2 - During muscle contraction, which band(s) of the...Ch. 10.2 - What role does the sarcoplasmic reticulum play in...Ch. 10.2 - What proteins compose the thick and thin...Ch. 10.2 - Why does skeletal muscle have a banded (striated)...Ch. 10.2 - Where does acetylcholine come from and what does...Ch. 10.2 - How do myosin and actin work together to make a...
Ch. 10.2 - Prob. 10BYGOCh. 10.2 - Prob. 11BYGOCh. 10.3 - Prob. 12BYGOCh. 10.3 - Prob. 13BYGOCh. 10.3 - Prob. 14BYGOCh. 10.3 - How are unitary and muliunit smooth muscle...Ch. 10.4 - Prob. 16BYGOCh. 10.4 - What is the principal difference between the way...Ch. 10.4 - Prob. 18BYGOCh. 10.4 - Prob. 19BYGOCh. 10.4 - Prob. 20BYGOCh. 10 - The scope of myology and of the term muscular...Ch. 10 - Prob. 10.1.2AYLOCh. 10 - Five physiological properties that muscle cells...Ch. 10 - Differences between skeletal, cardiac, and smooth...Ch. 10 - The internal ultrastructure of a skeletal muscle...Ch. 10 - Prob. 10.2.2AYLOCh. 10 - Prob. 10.2.3AYLOCh. 10 - The relationship between myofilaments, myofibrils,...Ch. 10 - Prob. 10.2.5AYLOCh. 10 - Prob. 10.2.6AYLOCh. 10 - Prob. 10.2.7AYLOCh. 10 - Prob. 10.2.8AYLOCh. 10 - Prob. 10.2.9AYLOCh. 10 - Prob. 10.2.10AYLOCh. 10 - The structure of a neuromuscular junction and the...Ch. 10 - Prob. 10.2.12AYLOCh. 10 - The components of a motor unit; what is meant by...Ch. 10 - Prob. 10.2.14AYLOCh. 10 - Prob. 10.2.15AYLOCh. 10 - Prob. 10.2.16AYLOCh. 10 - Prob. 10.2.17AYLOCh. 10 - Prob. 10.2.18AYLOCh. 10 - Prob. 10.2.19AYLOCh. 10 - Prob. 10.2.20AYLOCh. 10 - Prob. 10.2.21AYLOCh. 10 - The term for cardiac muscle cells, their...Ch. 10 - Prob. 10.3.2AYLOCh. 10 - Prob. 10.3.3AYLOCh. 10 - Prob. 10.3.4AYLOCh. 10 - Prob. 10.3.5AYLOCh. 10 - Prob. 10.3.6AYLOCh. 10 - Prob. 10.4.1AYLOCh. 10 - Prob. 10.4.2AYLOCh. 10 - Prob. 10.4.3AYLOCh. 10 - The mode of inheritance and pathology of muscular...Ch. 10 - Prob. 10.4.5AYLOCh. 10 - Prob. 10.4.6AYLOCh. 10 - A bundle of action and myosin myofilaments within...Ch. 10 - Muscle cells must have all of the following...Ch. 10 - A feature found in skeletal and cardiac muscle but...Ch. 10 - A feature found in smooth muscle but lacking from...Ch. 10 - Which of the following muscle proteins is not...Ch. 10 - Prob. 6TYRCh. 10 - Prob. 7TYRCh. 10 - Unitary smooth muscle cells can stimulate each...Ch. 10 - The calcium needed for skeletal muscle contraction...Ch. 10 - Prob. 10TYRCh. 10 - Prob. 11TYRCh. 10 - Prob. 12TYRCh. 10 - Prob. 13TYRCh. 10 - Prob. 14TYRCh. 10 - Prob. 15TYRCh. 10 - Prob. 16TYRCh. 10 - Prob. 17TYRCh. 10 - To activate the contraction of skeletal muscle,...Ch. 10 - Prob. 19TYRCh. 10 - A wave of contraction passing along the esophagus...Ch. 10 - Prob. 1BYMVCh. 10 - Prob. 2BYMVCh. 10 - Prob. 3BYMVCh. 10 - State a meaning of each word element and give a...Ch. 10 - Prob. 5BYMVCh. 10 - State a meaning of each word element and give a...Ch. 10 - Prob. 7BYMVCh. 10 - Prob. 8BYMVCh. 10 - Prob. 9BYMVCh. 10 - Prob. 10BYMVCh. 10 - Prob. 1WWWTSCh. 10 - Prob. 2WWWTSCh. 10 - Briefly explain why each of the following...Ch. 10 - Prob. 4WWWTSCh. 10 - Prob. 5WWWTSCh. 10 - Prob. 6WWWTSCh. 10 - Prob. 7WWWTSCh. 10 - Briefly explain why each of the following...Ch. 10 - Prob. 9WWWTSCh. 10 - Prob. 10WWWTSCh. 10 - Prob. 1TYCCh. 10 - Prob. 2TYCCh. 10 - Prob. 3TYCCh. 10 - Prob. 4TYCCh. 10 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax


Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Types of Human Body Tissue; Author: MooMooMath and Science;https://www.youtube.com/watch?v=O0ZvbPak4ck;License: Standard YouTube License, CC-BY