EBK BIOLOGY:SCIENCE F/LIFE
EBK BIOLOGY:SCIENCE F/LIFE
6th Edition
ISBN: 9780134819167
Author: BELK
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 10, Problem 3AAATB
Summary Introduction

To write:

The site at which the restriction enzymes cuts the DNA.

Introduction:

Genome is defined as the complete genetic material that is present in an organism. It consists of the coding as well as the non-coding parts of DNA. The study of the genome is termed as genomics. Restriction enzymes are widely used enzymes in the field of genomics. This enzyme was discovered by three scientists named “Werner Arber, Hamilton Smith, and Daniel Nathans”.

Blurred answer
Students have asked these similar questions
The partial sequence of one strand of a double-stranded DNA molecule is 5'-GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG -3' EcoRI is a restriction enzyme that cleaves after G in the sequence 5'-GAATTC-3'. PstI is a restriction enzyme that cleaves after A in the sequence 5'-CTGCAG-3'. Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The first strand of your duplex DNA fragment should be derived from the given strand sequence. 5'- -3' 3'- -5'
For the DNA sequence shown, indicate the products of its cleavage with the following restriction endonucleases (AKA restriction enzymes):5′-ACAGCTGATTCGAATTCACGTT-3′3′-TGTCGACTAAGCTTAAGTGCAA-5′a) EcoRI (the recognition sequence and cleavage site is G↓AATTC);b) AluI (the recognition sequence and cleavage site is AG↓CT).
You plan to clone exon 11 of the HEXA gene (Section C) into the multiple cloning site (MCS) of the plasmid vector pUC19 illustrated below. You PCR amplify only the 184 bp DNA region representing exon 11 of HEXA from human DNA as a blunt-ended dsDNA fragment, and purify the amplicon. Next you digest the vector pUC19 with the restriction enzyme (RE) Smal to obtain linear plasmid DNA. You mix the PCR product and linear plasmid, add some DNA ligase enzyme in an appropriate buffer, and incubate overnight at 16°C. The ligation mixture is used to transform competent E. coli cells, which are subsequently streaked out onto agar plates containing ampicillin, X-gal and IPTG. HEXA exon 11 sequence: attcagccagacacaatcatacaggtgtggcgagaggatattccagtgaactatatgaaggagctggaactggtc accaaggccggcttccgggcccttctctctgccccctggtacctgaaccgtatatcctatggccctgactggaag gatttctacatagtggaacccctggcatttgaag PUC 19 plasmid map: 2686 1 Amp 0 lacZ EcoRI (390) Smal (410) BamHI (420) MCS Kpnl (430) LacR binding site Plac Pstl…
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY