Campbell Biology: Concepts & Connections (9th Edition)
9th Edition
ISBN: 9780134296012
Author: Martha R. Taylor, Eric J. Simon, Jean L. Dickey, Kelly A. Hogan, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 10TYK
The base sequence of the gene coding for a short polypeptide is CTACGCTAGGCGATTGACT. What would be the base sequence of the mRNA transcribed from this gene? Using the genetic code in Figure 10.8A, give the amino acid sequence of the polypeptide translated from this mRNA. (Hint: What is the start codon?)
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine.
5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What would be the base sequence of the mRNA transcribed from this gene?
The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. From your answer to the last question, answer this
Using the genetic code, give the amino acid sequence of the polypeptide translated from this mRNA.
Use the three-letter abbrebviation of the amino acid and start with the start codon and stop in the stop codon.
What MRNA sequence codes the tripeptide shown below (write code in direction of N-terminus to C-terminus)?
IF MULTIPLE CODONS ARE ASSOCIATED WITH THE SAME AMINO ACID, USE THE FIRST CODON ON LIST. For example, use UCU for serine (not UCC, UCA, UCG, AGA, or
AGG).
You may need to use your textbook (p. 500-502) or look online for the structures of the 20 amino acids.
Use format XXX-XXX-XXX (capitals, dash, no spaces).
OH
HN
NH
Chapter 10 Solutions
Campbell Biology: Concepts & Connections (9th Edition)
Ch. 10 - Check your understanding of the flow of genetic...Ch. 10 - Which of the following correctly ranks the...Ch. 10 - Describe the process of DNA replication: the...Ch. 10 - What is the name of the process that produces RNA...Ch. 10 - Scientists have discovered how to put together a...Ch. 10 - A geneticist found that a particular mutation had...Ch. 10 - Describe the process by which the information in a...Ch. 10 - The nucleotide sequence of a DNA codon is GTA. A...Ch. 10 - A cell containing a single chromosome is placed in...Ch. 10 - The base sequence of the gene coding for a short...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codonarrow_forwardUsing the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A Garrow_forwardDecode the unknown word using the genetic code and fill out the missing nucleotides. Translate the generated mRNA sequence using the universal genetic code table and the information derived from the previous steps. Determine the unknown word by arranging the single letter amino acid code of the hypothetical protein produced bound by the start and stop codon.arrow_forward
- The following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.arrow_forwardConsider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for additional information. Part: 0 / 5 Part 1 of 5 What amino acid sequence is coded for by this mRNA? ☑arrow_forwardAssume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'arrow_forward
- Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)arrow_forwardWhat is the sequence of the mRNA molecule synthesized from the DNA template strand 5'-TAACGGTACGAT-3'? Enter the mRNA sequence using the one-letter abbreviations for the nucleotides. 5'- UAACGGUACGAU What amino acid sequence is encoded by the mRNA molecule 5'-AACGGAUCACUAACCUAC-3'? Assume that the reading frame starts at the 5′ end. Use a codon table to determine the identity of the translated peptide. Enter the amino acid sequence using three-letter abbreviations for the amino acids separated by hyphens (-). N-terminus Asn-Gly-ser-Leu-Thr-Tyr What is the sequence of the polypeptide formed if poly(UUAC) is added to a cell-free, protein-synthesizing system? poly(His-Ser-Phe-Ile) Asn-Glu-stop poly(Leu) Val-Ser-Lys-stop poly(Tyr) -3' poly(Leu-Leu-Thr-Tyr) C-terminusarrow_forwardConsider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-GCAAGUCUUAAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn 2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.arrow_forward
- Decode the unknown word using the genetic code and fill out the missing nucleotides. Translate the generated mRNA sequence using the universal genetic code table and the information derived from the previous steps. Determine the unknown word by arranging the single letter amino acid code of the hypothetical protein produced bound by the start and stop codon.arrow_forwardUsing the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAUarrow_forwardAn mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY