![GENETIC ANALYSIS: AN INTEG. APP. W/MAS](https://www.bartleby.com/isbn_cover_images/9781323142790/9781323142790_largeCoverImage.gif)
GENETIC ANALYSIS: AN INTEG. APP. W/MAS
2nd Edition
ISBN: 9781323142790
Author: Sanders
Publisher: Pearson Custom Publishing
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 1, Problem 19P
Consider the following segment of DNA:
5’-…ATGCCAGTCACTCACTTG…-3’
3’-…TACGGTCAGTGAGTGAAC…-5’
How many phosphodiester bonds are required to form this segment of double-stranded DNA?
How many hydrogen bonds are present in this DNA segment?
If the lower strand of DNA serves as the template transcribed into mRNA, how many peptide bonds are present in the polypeptide fragment into which the mRNA is translated?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' .
If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' .
If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
4th sequence (from the left) should be = TCG right?
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’
Write:
a) the sequence of the complementary DNA strand
Chapter 1 Solutions
GENETIC ANALYSIS: AN INTEG. APP. W/MAS
Ch. 1 - 1. Genetics affects many aspects of our lives....Ch. 1 - 2. How do you think the determination that DNA is...Ch. 1 - 3. A commentator once described genetics as “the...Ch. 1 - All life shares DNA as the hereditary material....Ch. 1 - Define the terms allele, chromosome, and gene and...Ch. 1 - 6. Define the terms genotype and phenotype, and...Ch. 1 - 7. Define natural selection, and describe how...Ch. 1 - Describe the modern synthesis of evolution, and...Ch. 1 - What are the four processes of evolution? Briefly...Ch. 1 - Define each of the following terms: a....
Ch. 1 - 11. Compare and contrast the genome, the proteome,...Ch. 1 - With respect to transcription describe the...Ch. 1 - If thymine makes up 21% of the DNA nucleotides in...Ch. 1 - What reactive chemical groups are found at the 5...Ch. 1 - Identify two differences in chemical composition...Ch. 1 - What is the central dogma of molecular biology?...Ch. 1 - A portion of a polypeptide contains the amino...Ch. 1 - The following segment of DNA is the template...Ch. 1 - 29. Consider the following segment of...Ch. 1 - 23. Fill in the missing nucleotides (so there are...Ch. 1 - 26. Four nucleic acid samples are analyzed to...Ch. 1 - 23. Are seed-eating finches among Darwin’s finches...Ch. 1 - 28. If one is constructing a phylogeny of reptiles...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.arrow_forwardGiven the following protein, which of the following sequences of TEMPLATE strand DNA would code for it? Pay attention to the polarity of the polypeptide and the strands of DNA that you choose. Use the codon chart to the right. AUG = met AAA = lys GCU = ala | CUU = leu ACU = thr -lys - thr - ala - leu - met (amino end) 5' TAC GAA CGA TGA TTT TAC ATT 3' 5' ATG CTT GCT ACT AAA ATG TAA 3' (carboxyl end) met 5' TAC TTT TGA CGA GAA TAC ATT 3¹' 3' TAC TTT TGA CGA GAA TAC ATT 5¹ 5' ATG AAA ACT GCT CTT ATG TAA 3¹ 3 TAC GAA CGA TGA TTT TAC ATT 5'arrow_forwardGive the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?arrow_forward
- Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’arrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.arrow_forwardWhich of the following pieces of DNA is going to be easier to separate into single stranded molecules using heat (ie, have a lower melting point), which breaks hydrogen bonds? Why? 1. 5’ ATTTTCCGTAAT 3’ 3’ TAAAAGGCATTA 5’ 2. 5’ ACGGTTTACCGG 3’ 3’ TGCCAAATGGCC 5’ A) 2; it has more C-G pairs which are connected by three hydrogen bonds instead of two, so they are easier to break. B) 1; it has more A-T pairs which are connected by one hydrogen bond instead of two, so they are easier to break. C) 2; it has more C-G pairs which are connected by two hydrogen bonds instead of three, so they are easier to break. D)1; it has more A-T pairs which are connected by two hydrogen bonds instead of three, so they are easier to break.arrow_forward
- As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardDetermine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. the tRNA 4. the formed amino acidsarrow_forwardDNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence 5’-CCG ATC GCA CAA-3’ Using this sequence as template after transcription no protein can be translated. Why? Presence of start codon Absence of start codon Due to mutation If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)? Substitution of C with G No change4 Deletion of Both I & IIIarrow_forward
- Once translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?arrow_forwardEukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?arrow_forwardWhich of the following single-stranded DNA sequences is most likely to form a stem-loop structure? GGATCACGTTACCGCC TCATAGGCGCCGTTCA TAAGTACATTACCCCG GACCGTATGCACGGTCarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY