Write a pseudocode for the real percentage-to-numerical-grade-equivalent displaying. Only one percentage score can be entered at a time. The grading scale is as follows: Grading Scale: Numerical Percentage value 5.00 -0 to 59.9; 3.00-60 to 64.4; 2.75-64.5 to 68.9; 2.50-69 to 73.4; 2.25 73.5 to 77.9; 2.00 -78 to 82.4; 1.75-82.5 to 86.9; 1.50-87 to 91.4; 1.25-91.5 to 95.9; 1.00-96 to 100

Write a pseudocode for the real percentage-to-numerical-grade-equivalent displaying. Only one percentage score can be entered at a time. The grading scale is as follows: Grading Scale: Numerical Percentage value 5.00 -0 to 59.9; 3.00-60 to 64.4; 2.75-64.5 to 68.9; 2.50-69 to 73.4; 2.25 73.5 to 77.9; 2.00 -78 to 82.4; 1.75-82.5 to 86.9; 1.50-87 to 91.4; 1.25-91.5 to 95.9; 1.00-96 to 100

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
Computer Science Part C: Interactive Driver Program Write an interactive driver program that creates a Course object (you can decide the name and roster/waitlist sizes). Then, use a loop to interactively allow the user to add students, drop students, or view the course. Display the result (success/failure) of each add/drop.
C++ Coding: Arrays Implement a two-dimensional character array. Use a nested loop to store a 12x6 flag. 5 x 2 stars as * Alternate = and – to represent stripe colors Use a nested loop to output the character array to the console.
C# language
In Python, grades_dict = {'Wally': [87,96,70], 'Eva': [100,87,90], 'Sam': [94,77,90], 'Katie': [100,81,82], 'Bob': [83, 65, 85]} write your own describe function that produces thesame 8 statistical results, for each one of the columns, that the built-in describe() function does.Note 1: Use the sample standard deviation formula (that is, the denominator is: N-1)Note 2: Your algorithm should work for any number of columns not just for 5Note 3: You can use the np.percentile() for the 25% and 75% percentile as well as the sort()built-in functions
An error that causes by failed code, is called as
Because it involves estimating a function's value at a point outside the data's range, this process is known as interpolation.
Explain how to use value parameters.
X =5 ; a = -3; b = 2