Write a DNA structure having 8 nucleotides.
Q: Which of the following statements is false? Select one: a. DNA, RNA and proteins are all composed…
A: DNA STRUCTURE:- DNA structure is given by Watson and Crick, who proposed the double-helical…
Q: 5.State the contribution of the following scientists to the understanding of DNA structure: a)Erwin…
A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…
Q: 2. A nucleotide is made of three parts: a and a group, a five carbon base. of the 3. In a single…
A: 2) a phosphate group, a five carbon Deoxyribose sugar,a nitrogenous base. 3) binds to the carbon of…
Q: 1. How do you determine the purity of DNA? If a DNA has 1.8 A260/A280 ratio, what does it mean? What…
A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…
Q: 2. Name the first complementary base from the 3' direction. Type your
A: RNA chain is synthesized from the 5' end to the 3'-hydroxyl group of the last ribonucleotide in the…
Q: 2. Fill in the labels on this diagram of a DNA molecule: Adenine Thymine .H2N OH NH H2N NH N' NH;…
A: DNA is deoxyribonucleic acid. It is a molecule of herdity. it is made up of nucleotides. A…
Q: I T?L|| ?L||?T |||| || |A| ||T|||c| |||| 6 4 5 “A. Denote the 5' and 3' ends of all of the DNA…
A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…
Q: 2. What polypeptide will be created from the following strand of DNA? DNA A T. T A C A C MRNA AA
A:
Q: #1 under Identify the Structures is what.... A. original strands of DNA B. backbone of DNA C.…
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule which is the genetic material in…
Q: 2. The image is of a nucleotide. a) Is this DNA or RNA? How can you tell? b) Mark the 5' carbon and…
A: Nucleic acids are found in all living organisms. They contain the genetic material of an individual.…
Q: 1. Calculate the size of the resulting fragments as they will occur after digestion and write the…
A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…
Q: 1. Last the 3 parts of a DNA nucleotide 2. List the 3 parts of an RNA nucleotide 3. List the 4 DNA…
A: "Since you have asked multiple questions, according to Bartleby's guidelines, we are only eligible…
Q: 1. How does the DNA structure reflect its functions? 2. What are the important features of the DNA…
A: The DNA molecule is made up of two strands that form a double helix shape as they coil around one…
Q: How many different bases are found in DNA
A: DNA is the genetic material in the majority of the living species. Deoxyribonucleic acid is made of…
Q: 2. How different would your DNA be if you had an identical twin? 3. Imagine that you are a forensic…
A: Identical twins are also known as monozygotic twins. They result from the fertilization of a single…
Q: 2. The percentage composition of a nucleic acid molecule found in bacterial cells is 32.3% adenine,…
A: Nucleic acids are polymers whose monomeric units are called nucleotides. Nucleotides have three…
Q: Which is NOT a difference between RNA and DNA? Select one: A. RNA contains uracil; DNA usually…
A: Introduction: Nucleic acids are molecules that store hereditary information for cellular growth and…
Q: One nucleotide strand of a DNA molecule has the base sequence illustrated below. 5′ –ATTGCTACGG–3′…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: 1. Write the complementary base sequence for the matching strand in the following DNA section:…
A: Introduction: Complementarity is the fundamental concept of DNA replication and transcription since…
Q: Identify the Structures is what? A. original strand of DNA B. DNA backbone C. nitrogen bases…
A: J.D Watson and F.H.C.Crick(1935) proposed a double helix model of DNA molecule, this is the widely…
Q: 2. In the space below, the two parallel lines indicate a section of double-stranded DNA that is…
A: 5' - 3' direction alludes to the direction of nucleotides of a solitary strand of Deoxyribose…
Q: 1. Write out the full name for DNA. 2. What is a gene? 3. Where in the cell are chromosomes located?…
A: DNA is the basic genetic and hereditary material in most eukaryotic organisms. It is a nucleic acid.…
Q: 25.) The area indicated by the arrow is the A) sugar-phosphate backbone B) minor groove C) major…
A: Biochemistry is a branch of biology that deals with the structure, function and interaction of…
Q: 9. Create a matching (complementary) DNA sequence for the following strand: A A A A A C CGA CCGATC
A: DNA is known to be the largest biomolecule in the cell. It is composed of two polynucleotide chains…
Q: 8. Shown below is a DNA strand. 5' GACGTACTACGACTATGGC 3' What is the correct representation of its…
A: Introduction: DNA is a type of nucleic acid present in the nucleus of the cell. It is a genetic…
Q: 5. Edit the DNA by changing all of the first triplet to AAA Check the new protein created by your…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
Q: 1. Write the complementary base sequence for the matching strand in the following DNA section:…
A: DNA or Deoxyribonucleic acid, is a complex molecule that contains all the genetic information which…
Q: 3. Write a DNA structure having 8 nucleotides 4. Write an RNA structure having 8 nucleotides.
A: DNA and RNA are two types of nucleic acid. DNA is considered to be more stable than RNA, hence it is…
Q: 2. A. B. C. The DNA of each species has a different base composition. Find the base composition of…
A: Nucleotide subunits made up DNA's structure. Deoxyribose along with a phosphate group, and one of…
Q: 3. Which of the following represents a similarity between RNA and DNA? A. The presence of Uracil…
A: DNA and RNA are both very essential biopolymers that sustain life. It is present in all forms of…
Q: Define the primary structure of DNA/RNA. Compare and contrast to the primary structure of proteins.
A: DNA/RNA are basically called as nucleic acid and it is important class of macromolecules which is…
Q: 9- Considering the structure of double-stranded DNA, which kind(s) of bonds hold one complementary…
A: Deoxyribose Nucleic acid (DNA) is the basic genetic material of life. It is made up of two strands…
Q:
A: Purines is equal to pyrimidines. So A=T C=G
Q: 1. When you simply look at the banding patterns on the gel from the DNA fingerprint we ran in lab as…
A: Gel electrophoresis is a molecular biology technique that is used commonly after DNA isolation to…
Q: 3. What nucleotide sequence would bond with the following strand? ATCGCCATA VWhy? Use evidence from…
A: The biochemical substance that is carried forward from the preceding generation to the succeeding…
Q: 4) Repetitive DNA comprises about _________ of chromosomal DNA A) 5% B) 40% C) 60% D) 95%
A: DNA is the genetic material in most living organisms. It carries information for synthesis of all…
Q: 1. Use the image below to complete the following: a. Label a phosphate b. Label a deoxyribose sugar…
A: DNA is a polymer of nucleotides. The backbone of DNA is composed of sugar phosphates. Nitrogenous…
Q: 2. What differentiates one DNA molecule from another? 3. How can you modify your DNA model to…
A: According to the rules of the Bartleby.com, only the first three questions will be answered in this.…
Q: 8. Which of the following diagrams best illustrates a DNA molecule? R R R CH, O H H3C CH3 H CH, O ||…
A: Genetics is the branch of biology that deals with genetic material like DNA, RNA, inheritance.…
Q: 2.Fill in the blank with the best answer. If band 3 (6 kB) in lane 5 contains 280 ng of DNA, then…
A: Fill in the blank the question. Average weight of one DNA base pairs= 650 Dalton. 1 Dalton =…
Q: 4). A scientist analyzed a segment of 1 point DNA from a human chromosome and found that the…
A: The correct answer is (c) Row 3
Q: 1. DNA is used to tell people apart. What aspects of DNA do you think make this possible? 2. What…
A: According to the questions, we have to provide the aspects of why DNA is used to tell people apart,…
Q: 1. Which of the following are generated due to the twisting of dsDNA? a. Hydrophobic bonds b. Van…
A: DNA acts as genetic material in most organisms. DNA is a double-helical structure in which two…
Q: 1. What are the differences between DNA and RNA? 2. What are the similarities between DNA and RNA?
A: Hereditary component of a cell which contains the information of the body and can be transmitted…
Q: 10) Which statement accurately describes DNA? A) Double Helix C) Remains in the nucleus D) All of…
A: DNA is deoxyribose nucleic acid which, and contain genes also.
Q: 6. What are the sides of the DNA ladder made of? a. b.
A: DNA or deoxyribonucleic acid is the molecule that contains genetic code of organisms. It forms a…
Q: 6. In the DNA structure below, indicate a hydrogen bond, a phosphodiester bond, a 5' phosphate and a…
A: DNA is the molecular term for the molecule in all living organisms that conveys genetic code. The…
Q: 2. A. Proteins stick to DNA through hydrogen bonds. Draw your choice of a correctly hydrogen bonded…
A: Hydrogen bonds are one most most frequently seen chemical bonds in biomolecules , whether it be in…
Q: 1. Which of the following nucleotides are the part of DNA? B) DTMP C) dUMP D) dTTP
A: We are authorized to answer one question at a time, since you have not mentioned which question you…
Q: 3. Illustrate a 15 nucleotide DNA molecule. Use the symbols: P for phosphate, S sugar and N…
A: DNA is a polymer of nucleotides which are linked to each other by 3'-5' phosphodiester bond.
3. Write a DNA structure having 8
Step by step
Solved in 2 steps with 1 images
- What are the base-pairing rules for DNA? a. A-G, T-C b. A-C, T-G c. A-T, G-COne species' DNA differs from others in its _______ a. nucleotides b. DNA sequence c. sugar-phosphate backbone d. all of the aboveIf a segment of DNA is 5 CATTAC 3, the complementary DNA strand is (a) 3 CATTAC 5 (b) 3 GTAATG 5 (c) 5 CATTAC 3 (d) 5 GTAATG 3 (e) 5 CATTAC 5
- 3. Write a DNA structure having 8 nucleotides 4. Write an RNA structure having 8 nucleotides.4.Write an RNA structure having 8 nucleotides.8. Which of the following diagrams best illustrates a DNA molecule? R R CH2 O H,N-C-C-N-C-C -N-C-C CH2 O H CH, O H H3C CH3 H H. H нн CH3 Peptide Bonds- HO, GC HC3» NH )=P-O– CH2 O. H Nitrogenous base Phosphate (thymine) group ОН Sugar
- 22. DNA is made up of Group of answer choices guanine, thymine, deoxyribomucleic acids Guanine, cytosine, deoxyribonucleic acid ribonucleic acid, phosphate, cytosine ribonucleic acid, cytosine, guanine3. Illustrate a 15 nucleotide DNA molecule. Use the symbols: P for phosphate, S sugar and N nitrogenous base, respectively. Label your drawing properly.9. Differentiate between DNA and RNA based on the following characteristics. [4] DNA RNA Base composition Number of strands
- 3. For this short DNA segment, a. identify the 5' end and the 3' end of the molecule. b. circle the atoms that comprise the backbone of the nucleic acid chain. c. write the nucleotide sequence of this DNA segment. P-OCH, CH, HN OP-OCH, NH, OCH, OH 4. A DNA strand has the sequence ATGGCAATCCTCAAACGCTGT a. What is the sequence of the complementary DNA strand? b. What is the sequence of the mRNA that would be produced during transcription from the original strand of DNA? 5. Write the codon on mRNA that would pair with each tRNA anticodon. a. UUG b. GAA c. UCC d. CAC2. What shape/structure is DNA often described as? * Your answer1. the position that distinguishes between DNA and RNA is 2. the carbon that the phosphate group is attached to is 3. the carbon that the base is attached to is 4. the nucleotide in a growing strand would be attached to