Why thumb is not considered as a finger? Give at least 9 reasons. (Explain this according to the Toulmin method if you can do so...)

Q: 46. Vertigo :- Select one: a. is a post-rotational sense of being rotated toward opposite side of…

A: The vestibular apparatus is the inner ear's non-auditory part.  It has three primary functions in…

Q: Why is it import for me to embody a healthy lifestyle as a kinesiogy Major?

A: Kinesiology is the science of the mechanics and anatomy of body movements, as well as their effects…

Q: The introduction to this chapter discussed a study of telomere length in Romanian children. The…

A: Telomeres are the ends of the eukaryotic chromosomes. The telomeric sequences are highly conserved…

Q: What is Sit and Reach? What is the purpose of it?

A: Flexibility test It assesses the joints and muscles ability of range of motion.  Types: Shoulder…

Q: 10 pointsOn the surface of the eye is a transparent, flexible covering called the cornea. This…

A: The cornea can be defined as a outer layer present in the front of the eye. It is transparent and…

Q: What is the pointed structure made of?

A: The picture is probably showing the hexagonal cells. The cell is the basic structural functional…

Q: 1. pointed structure? 2. What is #1 it made up of? 3. pointed structure? 4. significance of #3? 5.…

A: 1) Ectoderm of head 2) Ectoderm is the layer of skull and it differentiates to form epithelial and…

Q: 8. ( ligament) what essential properties would you incorporate in your design? What type of material…

A: Anterior Cruciate Ligament(ACL) in the knee joint originates from femoral and tibial mesenchyma. It…

Q: What is the difference between an eyelid tic and an eyelid twitch?

A: The eyelid can be defined as the thin fold of the skin that covers and protects the eye. The levator…

Q: Considering the complexity in a healthy human knee, describe the motions available, including planes…

A: Knee motion is believed to occur about a variable flexion-extension  axis perpendicular to the…

Q: What are the different lenses used for? 3) What kind of shape does the lens have in the eye? 4)…

A: The human eye is the organ that is used for the sensation of vision. But sometimes some defects can…

Q: Explain why eating and coughing may be difficultin a person with severe ankylosing spondylitis.

A: Severe ankylosing spondylitis is a sort of persisting arthritis condition that impacts the spinal…

Q: What do you mean by sharpey schafer fibres?

A: Sharpey's fibres are otherwise known as bone fibres or perforating fibres is a matrix that helps to…

Q: Discuss the following questions. 1. What is the area vitellena? 2. Is the primitive stalk still…

A: After implantation, growing hypoblast cells produce the main yolk sac. The inner cell mass splits…

Q: Why does the BP and HR change again when maintaining the position transfer?

A: BP or Blood Pressure is the lateral pressure that the stream of blood exerts on the walls of blood…

Q: What are prosthetic groups?

A: The enzymes have various regions that either helps in the enhancing of the reaction or help in the…

Q: What is the function of tip links?

A: Tip links are thought to be an essential element of the mechanoelectrical transduction (MET)…

Q: Define appositional growth

A: Appositional growth is the increase in diameter of the bones by addition of the bone tissue at the…

Q: Define Flexors? Give one example of it?

A: Muscles in the body can be  a flexor,  extensor or a stabilizer depending on  It's action  and…

Q: If a prime mover muscle such as the pectoralis major is surgically removed, how will the actions…

A: Pectoralis major is a muscle located at the chest of the body of humans. It is a fan-shaped thick…

Q: 3. Which structure mainly provides the web space in hand? Select one: a.Carpal-metacarpal-finger…

A: If we talk about hand anatomy, it is the most distinct part of the upper limbs. It consists of bones…

Q: 5. Which positioning would you choose for Flumist? Why?

A: FluMist is a flu vaccine in the form of a nasal spray and is administered through the nose to…

Q: why and how dribbling can help you become a better basketball player?   2. what the physical…

A: In basketball dribbling is a manual where one player keeps moving in a given direction with the ball…

Q: Your knees should be bent at a comfortable and greater than 90 degrees flexion when sitting in front…

A: Body mechanics is the coordinated effort of the nervous system and musculoskeletal system to…

Q: Curl Tense Flexibility Physical bending Mental Hand Shrug 1. Make fists of your_ 2. Lyour shoulders…

A: Make fists of your hand. Shrug you shoulders up to your ear. Tense your arm by bending at the elbow…

Q: Letter drawn by group Mutation if any Result/Trait(s) A AAGGGCUUAUUC Extra long nails on digits B…

A: The process of gradual changes in organisms to form more and more complex forms over a long period…

Q: 3. What is the difference between the coarse adjustment knob and the fine adjustme knob? When is it…

A: Coarse adjustment knob: it is used to raises and lowers the stage more rapidly. It is the large…

Q: Watch this video (http://openstaxcollege.org/l/anklejoint3) to learn about the ligaments of the…

A: Ankle joint is formed of distal tibia, fibula, and the talus. The ankle joint is also called as…

Q: What are the pointed structure

A: Introduction Bone tissue can be divided into the following categories: A-Compact bone ; mainly…

Q: Consider the movements of plantar flexion and dorsiflexion. Propose a reason why there are far more…

A: The ankle joint observes four types of movements, two of which are dorsiflexion and plantarflexion.…

Q: The knee cap is also called the

A: Q. The knee cap is also called the Answer. Patella

Q: A pair of siblings watched as their mother flatten one of two equal-sized balls of clay into a flat…

A: Unlike wild animals, the young humans have a wide learning curve. Usually they do not have to face…

Q: Whenever the position of a joint is stabilized at a certain attitude, the nervous system produces…

A: Alpha motor neurons refer to the lower motor neurons of the spinal cord and brainstem that are…

Q: What does radial loop-scaffold accomplish?

A: Introduction: Eukaryotic DNA is condensed to the following stages: Metaphase chromosome that is…

Q: Determine the results of an insertion of TA between positions 2 and 3.

A: 5' GTAGGGAGAACGAGACAATCTG  3' DNA 3' CATCCCTCTTGCTCTGTTAGAC  5'   5'GUAGGGAGAACGAGACAAUCUG 3' mRNA…

Q: Enables you to adduct your arm and shoulder dorsally (across the back)?

A: ▪︎ Latissimus dorsi is the muscle which enables to adduct your arm and shoulder dorsally . ▪︎ It is…

Q: Fill in the blank:  Stroking the sole of the foot in infants results in dorsiflexion and toes that…

A: The brain is the main part of the body that controls every action in our body. It is located in the…

Q: Vertigo :-a- is a post-rotational sense of being rotated toward opposite side of original rotationb-…

A: The non-auditory part of the inner ear is referred to as the vestibular apparatus. It is involved in…

Q: list 3 core task which related to ergonomic factor.

A: Ergonomic factors are concerned with the people and their work. There are some hazards of work which…

Q: Describe wrist and finger in full extension. Provide a biomechanical and physiological explanation…

A:

Q: What is the role of telomeres? What happens if they do not function correctly?

A: DNA replication is the process by which new DNA is synthesized from the old DNA by semiconservative…

Q: Identify the actions of the superior olivary complex.

A: The superior olivary complex is also referred to as the superior olive. It is a collection of…

Q: For Total knee prothesis, Titanium,Aluminimum, vanadium and NE how are this material suitable for…

A: When a person has an injured or deteriorated bone or joint, but it is beyond repair by using the…

Q: The hypodermic point of injection of tissue builder in the temporal region is the lateral end of the…

A: A syringe and needle are used to inject a specific liquid into the tissues. It's done to bring back…