Q: What are the etiologic factors, clinical findings, and management of excess and deficiency of the…
A: Hormones are the chemical messengers which are secreted from specialised endocrine glands directly…
Q: . The pedigree below was obtained for a rare kidney disease. a) Deduce the inheritance of this…
A: Introduction Genetic disorder are of two types, autosomal and sex linked. In autosomal genetic…
Q: 38. Hydrocortisone is an anti-inflammatory drug that stabilizes lysosomal membranes. Explain how…
A: Introduction : Lysosomes are membrane-bound organelles and the area within the membrane is called…
Q: Can you test the activity of topoisomerases doing in vitro assays? How?
A: Topoisomerases are the nuclear enzymes which play an essential role in the process of DNA…
Q: The processed meat factories that are continuously producing food for the people is compared to…
A: Any meat that has undergone modifications to enhance its flavor or lengthen its shelf life is…
Q: What does translucent spot mean with regards to lipid? Identify the control for this test. 1.…
A: Introduction Lipids are macromolecules like proteins, nucleic acids, and carbohydrates. These are…
Q: 2. Compute for the calibration factor. Show your solution. CF = stage micrometer divisions subtended…
A: Micrometry signifies the measurement of the microscopic object in in terms of length, diameter,…
Q: Which event may take place before metaphase? ODNA replication O separation of sister chromatids O…
A: A cell cycle is a series of events that takes place in a cell as it grows and divides.
Q: Process when an offspring develops within the mother's womb
A: Introduction The joining of a human egg and sperm takes place in the fallopian tube's ampulla and…
Q: The image of these living HeLa cells are most likely from:
A: Different types of microscopy are used in the magnification and imaging of cells. Some routinely use…
Q: Sorry I forgot to give you the options to answer. Protein Identity Cell Structure Energy…
A: Plants produce carbohydrates as a sort of molecule during photosynthesis. They are composed of three…
Q: The hsr-omega gene is induced by heat stress and is part of the conserved heat shock response system…
A: Introduction : The species of fly known as Drosophila melanogaster is a member of the Diptera…
Q: Which of the following exert their cell signaling ability proteteolysis of other proteins? multiple…
A:
Q: How does mitosis result in daughter cells containing identical number and same DNA with its parent…
A: When identical chromosomes are paired together during meiosis, a biological event called crossing…
Q: Which of the following is removed when tea is brewed in hot water? A. Cellulose B. Tannins C.…
A: Introduction:- Tea is used to make healthy drink as it contains different types of phytochemical…
Q: 12. 1 B Required Study the diagram of the cell in the solution shown in the beaker below. 90% H₂O…
A: The diagram shows a cell containing 10% solute and 90% water in a beaker containing a solution of…
Q: Label the parts and indicate the movement of water in and out of the cell
A: To distill anything, we must boil it and condense the vapors in a separate container. Substances…
Q: Which of the following marks an important event during telophase? movement of chromosomes at the…
A: Mitosis is a cell division process in which the chromosomes replicate and are evenly distributed…
Q: Please answer
A: Prophase is the first stage of cell division, before metaphase, during which the chromosomes become…
Q: In which stage of the cell cycle do cells grow and accumulate all necessary molecules in preparation…
A: Cell division is a phenomenon in which parent cell splits off and gives rise to novel cell . Number…
Q: Explain why it makes sense for the PDH complex in liver to be active when dephosphorylated.
A: Pyruvate Dehydrogenase Complex(PDH) is a multienzyme complex that is involved in pyruvate…
Q: If I have to compare this organelle to the offices in the city, it is the Cotabato Light Company for…
A: Cell is the basic structural and functional unit of life. It has various organelles such as…
Q: * (a) Copyright © 2003 Pearson Education, Inc. publishing as Benjamin Cummings, What is the…
A: Given diagram shown is of Chromosome. It is the thread like arrangement of DNA molecule which is…
Q: What clinical and laboratory findings would lead to a diagnosis of liver cirrhosis?
A: Acute or chronic liver damage which can be caused by various liver diseases like hepatitis or due to…
Q: Please write introduction paragraph on the topic about about human germline gene editing using…
A: Successful somatic and germline genome editing is becoming possible thanks to CRISPR/Cas9 and other…
Q: What are the acute and chronic complications of diabetes mellitus?
A: A series of illnesses together referred to as diabetes mellitus alter how the body utilises blood…
Q: Are Monkeypox and Smallpox the same? What are the similarities and differences? Include in your…
A: Orthopoxvirus is a genus of viruses in the Poxviridae family and the Chordopoxvirinae subfamily.…
Q: ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAAT…
A: The simplest definition of gene expression is the production of the gene's complementary protein,…
Q: coding strand A mutated sequence of DNA CA C GA AT TAGAT GG 5' 3, 5' C T AT GT G C T TA ATC TAC C…
A: Coding strand of DNA:- The DNA strand present in the direction of 5' to 3' acts as coding strand.…
Q: The broad thin ears of this African elephant help dissipate heat during hot days of its habitat - a…
A: Introduction : Evolution is the process through which modern creatures have evolved from their…
Q: Why might it be hypothesized that sour would be perceived more quickly than bitter or sweet?
A: Introduction There are two types of cells that make up the bud: supporting cells and gustatory…
Q: The heart working with blood vessels to transport blood throughout the body is a type of the…
A: The heart is a strong muscular organ that helps pump blood via the blood vessels. The arteries and…
Q: Prior to publication in a scientific journal, an article must undergo the process of peer review. In…
A: Introduction: The abbreviation IMRAD encapsulates the fundamental organisation of a scientific…
Q: Our policemen and soldiers help the city to be in its proper shape, ensuring the city is in order.…
A: Introduction Inside cells, organelles are specialised structures that carry out a variety of tasks.…
Q: what do you think is the best metabolic process for energy-producing nutrients? Also, what do you…
A: Metabolism is a process that takes place in animal and plants where the food is converted into…
Q: A nutritionist is interested in collecting data to develop a healthy eating program at a local high…
A: A graph is a pictorial representation or diagram that represents data or values in an organised way.
Q: Models Have Limitations Since models are simpler than real objects or systems, they have…
A: Science is the coolest subject that revolves around every testable and prediction around the world.…
Q: A classic dataset on wing coloration in the scarlet tiger moth (Paneaxia dominula) shows that…
A: A trait is a characteristic feature that is unique to particular individual. Each trait is…
Q: The following type of metabolic reaction add together monomers (small repeating building blocks or…
A: Any self-regulating process, such as homeostasis, helps an organism retain stability while…
Q: EXAMPLE Two mules mate but never produce offspring Lions (Africa) and tigers (Asia) in the wild An…
A: Reproductive isolation is a strategy that prevents species from either mater or producing viable…
Q: 1. SARS-CoV versus SARS-CoV-2 Compare the protein sequence of the SARS-CoV and SARS-CoV-2. Do you…
A: The pandemic of the disease called COVID-19 is caused by the virus called SARS-CoV-2 virus. The name…
Q: Under what conditions when the Renkin-Crone equation can be applied? Why? Give an example situation…
A: Renkin-crone Equation : The renkin- crone equation shows that the transport from the blood in…
Q: What are the subtypes of bipolar disorder?
A: Bipolar disorder is a type of mental disorder in which there is a change in moods and depressive…
Q: What factors predispose to formation of cholesterol gallstones?
A: There is a small organ in our body just under the liver, this is called as gall bladder. The gall…
Q: Which important phenomenon is both inspected during g1 and g2 checkpoints of the cell cycle ODNA…
A: The cell cycle is the progression of a cell via various phases to complete cell division. The phases…
Q: What are the general mechanisms of action of lipid-soluble and water-soluble hormones on target…
A: Hormones are chemical compounds that function in the body as messenger molecules. They are created…
Q: 1. list all the similarities between DNA and chromosome
A: The nucleic acids found in the cells are DNA and RNA. DNA resides in the nucleus while RNA can be…
Q: Instructions: Species name 1: Sample illustration: Taxonomic account (domain to species): At least…
A: Introduction R. H. Whittaker’s classification system divides organisms into five major groups. These…
Q: (40 OA Diatoms Living or prepared slide Magnification: Toox O O Diatomaceous earth Student…
A: Sand filters are used to filter the impurities present in the pool water. Diatomaceous Earth is a…
Q: f. What is the temperature inside the laboratory refrigerator? 8- What is the temperature inside the…
A: We are allowed to do one question or up to three subpart of a question. Please repost the undone…
Why is translocation important to plants?
Step by step
Solved in 2 steps
- Why is the DNA yield higher from 1g of strawberry compared to 1g of Arabidopsis leaves when both are homogenised by hand?What is a homolog? With regard to genes and alleles, how arehomologs similar to and different from each other?How do translocations such as the Philadelphia chromosome contribute to cancer?