Why is it easier to separate the strands of a DNA molecule at pH > 11?
Q: If the nucleotide sequence of one strand of DNA is 5′ ACGTTGCA 3′, what is the sequence of the…
A: In molecular biology, the DNA is made of two complementary strands which runs antiparallel to each…
Q: What is the "pucker" conformation of deoxyribose in the B-form structure of DNA? C2-endo…
A: Sugar puckering :- geometry of ribose sugar have 5 endocyclic TIRTIONAL ANGLES.
Q: Between which types of compounds in a double-stranded DNA molecule must the bonds break before…
A: -DNA replication is the biologucal process of producing two identical replicas of DNA from one…
Q: During gel electrophoresis, DNA molecules can easily be separated according to size because all DNA…
A: Introduction Gel electrophoresis is very well known and efficient technique to separate out DNA/RNA…
Q: Why is DNA present in a double stranded form and not single stranded in organisms?
A: As we know DNA is the basic unit of inheritance and it resides in a well-protected nucleus. DNA is…
Q: If the sequence of one strand of a DNA molecule is 5’-AGCCCCGACTCTATTC-3’, what is the sequence of…
A: DNA : Deoxyribonucleic acid is a double stranded molecule in which two strands are anti parallel and…
Q: If DNA concentration is 2 grams, what would be the molar concentration of human DNA in a human cell?
A: Molar concentration is sometimes referred to as molarity, concentrations of an amount, or content of…
Q: Why would dispersion forces not work as a way to hold the two strands of DNA together? Why would…
A: The helical structure of DNA is stabilized by a number of interactions. There are two types of…
Q: Which of the following equations are true for double-stranded DNA? a) (%G+%T) =(%A+%C) b) (%G+%A)…
A: DNA stands for deoxyribonucleic acid. It is a genetic material that passes from one generation to…
Q: How many strands does DNA and RNA have? Where is RNA and DNA located in a cell? What type of sugar…
A: DNA is made up of a series of building blocks called nucleotides. The RNA , more specifically mRNA…
Q: Would you expect RNA molecules to behave in the same manner as DNA during gel electrophoresis? Why…
A: Gel electrophoresis is the technique where macro molecules especially proteins and nucleic acid are…
Q: Which nucleotide is most non-polar and why? What structural element of DNA gets cleaved by…
A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…
Q: What is the axial ratio (length:diameter) of a DNA molecule 20 μm long?
A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…
Q: What is the structure of the gel stain being used? There are several other dyes that can bind DNA…
A: Gel staining is very important visualization and detection procedure that follows protein…
Q: What form of DNA corresponds to the Watson-Crick double helix structure? A form Z form…
A: DNA, the molecule carrying the genetic instructions in all living beings, is a polymer of…
Q: What are the four nitrogenous bases and which bases pair with one another in a double-stranded…
A: DNA is a double helical structure that contains genes. Genes are the functional unit of heredity in…
Q: Why is strand separation beneficial?
A: DNA is a double-helix, with two strands held together by hydrogen bonds between the base pairs.
Q: If the DNA molecule were placed in boiling water, how would the molecule change?
A: DNA or deoxyribonucleotide is the genetic material of organisms. It is a double helical structure…
Q: DNA sample which is approximately 600 base pairs long. What percentage of Agarose would you make…
A: The biochemical molecule that is built up with two polynucleotide chains is called DNA…
Q: Does the design of the Hershey–Chase experiment distinguish between DNA and RNA as the molecule…
A: Introduction: Hershey and Chase performed an experiment on the bacteriophage having DNA and protein.…
Q: Which one of the three parts to a nucleotide is used to determine the 5' to 3' direction of a DNA…
A: A consequence of the structure of nucleotides is that a polynucleotide chain has directionality –…
Q: IF A DOUBLE-STRAND DNA SAMPLE WAS COMPOSED OF 10 PERCENT THYMINE, WHAT WOULD BE THE PERCENTAGE OF…
A: The deoxyribonucleic acid is the genetic material that is passed from one generation to the next…
Q: Why is the separation possible given that all the DNAs (of close circular DNA, open circular DNA and…
A: Gel electrophoresis is a technique used to separate DNA fragments based on their size and charge. An…
Q: Which travels the farthest shorter or larger fragments of DNA? Why?
A: The technique that is used for the separation of DNA based on its size is referred to as gel…
Q: Explain why the strands of a DNA molecule can be separated more easily at pH > 11.
A: pH is defined as the power of hydrogen ion concentration. As the H+ ion concentration decreases the…
Q: Open the bag of fruit and add 2 teaspoons of your DNA extraction buffer. What are cell membranes…
A: Cell is a structural and functional unit of all organisms. The cell was discovered by Robert Hooke…
Q: If the sequence of bases on the one of the strand of a DNA molecule 5’ATTGCGGA - 3’ What is the…
A: DNA is a double helical structure composed of nucleotides.The two helices are joined together by…
Q: What is the concentration of a DNA solution that absorbs 0.812 and 0.463 at 260 and 280 nm,…
A: Deoxyribonucleic acid (DNA) is the genetic material. It is polymer of nucleotides. The protein…
Q: what happens to the intactness of DNA if extracted DNA fibers were placed in buffer of pH 3?
A: Extracted DNA is generally stored in neutral pH.
Q: During agarose gel electrophoresis, why does DNA move through the gel when electric current is…
A: Gel electrophoresis is basically a method that aid in separating DNA fragments and other molecules…
Q: The two strands of a DNA double helix can be separated by heating. If you raise the temperature of a…
A: A double-stranded DNA is joined together by a bond and seems to be a twisted ladder. Which is…
Q: 1. Phosphate 2. Ribose sugar 3. Deoxyribose sugar 4. Uracil 5. Thymine 6. Adenine 7. Guanine 8.…
A: Adenine is the nucelotide which join to the deoxyribose sugar and binds to the thymine nucleotide
Q: What is generated from the replication of DNA ? what method is used ? Describe the process. What are…
A: The process of DNA replication is one of the first processes that is described in the central dogma.…
Q: products obtained from hydrolysis of DNA by an acid?
A: Acidic hydrolysis of deoxyribonucleic acid (DNA) constitutes the usual way to obtain the…
Q: Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents…
A: Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) Sense strand is also known as…
Q: The base composition for one of the strands of a DNA double helix is 19% A, 34% C, 28% G, and 19%…
A: Deoxyribonucleic acid(DNA) is a double helix molecule that carries all the genetic instructions of…
Q: If a double-stranded DNA molecule is 22% G, what is the percentage of A, T, and C? Explain.
A: Chargaff rule states that DNA from any species of any organism should have a 1:1 stoichiometric…
Q: 1.3 Considering the atomic structure of DNA shown below, what are the features of the molecule that…
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…
Q: Which of the following DNA strands below is expected to have the highest melting temperature?
A: DNA is the genetic material in living beings. It can be seen both in prokaryotes and eukaryotes. The…
Q: Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and…
A: The complementary DNA sequence of DNA coding strand ATGATTATCCTATAG is TACTAATAGGATATC.
Q: What does it mean for DNA to be antiparallel? -The two strands of polynucleotides are in opposite…
A: DNA is the hereditary material found in an organism.
Q: What are the features that make the structure of the DNA stable? Explain why the DNA is the genetic…
A: The 3Dimentional double-helical structure of DNA molecule was given by James Watson and Francis…
Q: If the first strand of DNA is AGCTGCAAT, what would be the nitrogen base sequence of the second…
A: DNA is a biomolecule which contains two strands. Each strand has a backbone composed deoxyribose…
Q: The two strands of a DNA double helix can be separated by heating. if you raised the temperature of…
A: In the DNA strands, between every A-T base-pairing there are two hydrogen bonds present while In…
Q: Why do higher salt concentrations stabilize the DNA double helix? Or What aspect of the structure of…
A: DNA is the double helical structure in which both the strand are antiparallel to each other. The…
Q: Which would you expect to have a higher entropy: DNA in its wellknown double-helical form, or DNA…
A: The entropy of a system decreases when two single stranded DNA molecules come together and form a…
Why is it easier to separate the strands of a DNA molecule at pH > 11?
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.If one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite it on the other strand? Enter the complementary sequence of letters separated by hyphens. • View Available Hint(s) 3'- 3'-G-A-T-C-G-C-A-A-T-5' -5'8.2 nucleotide double helix Vocabulary Check base pairing rules Ma in UU 1. Label the drawing at the right with the terms nucleotide, base pairing rules, and double helix. Write each term and draw a line that connects the term to the appropriate part of the drawing. A Р P PDP D D C TCXA D. GXC P 0 100 CXG P P D ICXA P D P G D D CXG DL TCXA D D TCXA P CXG P P P AXT D P GC P D D 0 D P P P P GCD
- DNA contents of nitrogenous bases • %A = %T %C = %G • A+G = C+T %3D Example: if 35% of the bases of a DNA - molecule is thymine what the % of Cyosine?For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandHere is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?
- If I have a DNA sequence of 5’ ATTGGCCGCA 3’, what is the complementary strand?5.1) Do you expect DNA strands 1 and 2 below to have the same melting point? Justify your answer. Strand 1: 5′ATTATTTTAAATTTAGCGC3′ Strand 2:5′AAAAAATTTTTTTTTCCGG3′ 5.2) A newly discovered blob protein folds very rapidly in the presence of protein disulphide isomerase and peptidyl prolyl cis-trans isomerase enzymes but aggregates and never folds correctly without protein disulphide isomerase. Explain why this might occur.34. Draw double-stranded DNA (two basepairs long with one AT basepair and one GC basepair). Your drawing should be flat; do not draw the twist of the helix. Be sure to include the 5’-P, 3’- OH, deoxyribose sugar rings (with carbons 1’-5’ and the O indicated), and a simplified phosphodiester bond (O-P-O). Show purines as two differently-sized rings and pyrimidines as one ring and show the correct number of hydrogen bonds between bases. The dsDNA must be antiparallel. Drawing a simplified version of dsDNA will help you gain a better understanding of the concepts underlying dsDNA structure. It will most likely take a couple of tries to get a clear figure.
- Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’The top side of this figure offers more opportunities (for each base pair) that can lead to highly specific protein-DNA interactions. True or False? Major groove Major groove (a) Major groove Major groove O True N-HI110 O False A NIIH-N Minor groove Adenine-Thymine CH3 0111H-N H₂C OFITH 98 TN- GN-HIIN V-HillO Minor groove Guanine Cytosine Minor groove Thymine-Adenine Hillo C NIH OIH -NG Minor groove Cytosine GuanineGiven the active site diagram below, please identify the residue participating in a charge-charge interation. HO OH HN OH 5 ΝΗ *HN ΝΗ OH O Zn²+ 2 4 5 3 1 2 NH 3
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)