Q: What are the 3 important components to Chloroplast?
A: Chloroplasts are plant cell organelles that convert light energy into relatively stable chemical…
Q: Label the following diagram using the bank of words provided. 107 109 110 106 108 matrix a. b. outer…
A: The first diagram represent mitochondria, second depicts chloroplast and third represents DNA…
Q: Do onion cells have chloroplasts? Explain.
A: Plastids are double membraned cell organelle found only in plant cell. They help in photo synthesis,…
Q: Why are there no chloroplast in onion cells?
A: Chloroplasts are present in plant cells and are involved in photosynthesis due to the presence of…
Q: What does chloroplast DNA do?
A: A chloroplast is a green pigment molecule in plants that is engaged in the photosynthesis process. A…
Q: Characteristics and importance of Chloroplasts
A: Chloroplasts are a type of membrane-bound plastid containing a network of membranes that contain a…
Q: Why is the chloroplast green?
A: Chloroplasts are organelles found in plant cells and eukaryotic algae that conduct photosynthesis.…
Q: What are the major similarities and differences between ATP synthesis in chloroplasts, as compared…
A: Adenosine triphosphate (ATP) is the energy carrying molecule where it observes the chemical energy…
Q: What is the most important function of chloroplast?
A: There is a special organelle in their cells known as chloroplasts. It is absent in animal cell.
Q: What is the difference between structure and function of Mitochondria and chloroplast
A: Mitochondria is called the powerhouse of the cells found in both plants and animal cells .…
Q: In what ways are chloroplasts like mitochondria? How are they different?
A: The cells contain cellular organelles such as nucleus, ribosomes, endoplasmic reticulum, Golgi…
Q: Which of the following is not present in all eukaryotic cells? O lysosomes chloroplast | cell wall…
A: Eukaryotic cells : These cells are cells which consists of true nucleus . These are larger than…
Q: Describe the structure of the chloroplast.
A: A chloroplast is a major site for the photosynthesis reaction process.
Q: Explain the structure of chloroplast.
A: Organisms are earlier classified into two main categories known as prokaryotes and eukaryotes.…
Q: In a plant cell, what is found in the chloroplast that gives the plant its green pigment?
A: Chloroplast- In plant cell this organelle plays a very important role in conduction of…
Q: how does metabolism in chloroplasts differ from that of mitochondria?
A: Chloroplasts are a kind of organelles found in plant cells and eukaryotic algae that conduct…
Q: What are chloroplast give an example?
A: Photosynthesis is one of the process through which the plants obtain energy. It is an enzyme…
Q: Two ways in which chloroplasts resemble mitochondriaare the presence of inner and outer membranes,…
A: Chloroplasts and mitochondria are both double-membrane layered cellular organelles present in…
Q: Describe the structure of chloroplasts.
A: Introduction: Chemical energy is stored in organic compounds in living organisms and turned into…
Q: organelle functions in cellular respiration
A: Cellular respiration is a metabolic process in which glucose is broken down to form ATP, the energy…
Q: Discuss the structure and functions of chloroplast .
A: Chloroplasts are the cell organelles that found only in eukaryotic algal cell and plant cells.…
Q: Why are chloroplasts green?
A: The cells are the basic building blocks of the living system. It consists of many internal…
Q: The chloroplast has a highly organized structure. How doesthis structure help make photosynthesis…
A: Step 1: Photosynthesis is the process by which plants, certain types of bacteria, and algae convert…
Q: What macromolecule would NOT be created if all chloroplasts were removed from a plant cell? *
A: Plants prepare food by the process of photosynthesis. In this process plants prepare food from…
Q: Unlike mitochondria, chloroplasts contain a distinct third membrane called the _____________…
A: Chloroplasts are the plant organelles that help in the photosynthesis process. This along with…
Q: Structures found in a plant cell, but not an animal cell, include the following: Chloroplasts, a…
A: A plant cell is a structural and functional unit of plants whereas, animal cells are basic units of…
Q: draw chloroplast diagram?
A: A chloroplast is an organelle found in the plant cells. It captures the solar energy which is…
Q: In the image above, the small round dark blue/purple structures are Mitochondria. Starch granules.…
A: Answer given below
Q: What is Granum in chloroplast?
A: Chloroplast is an organ present in the plant cell. The chloroplast helps in the photosynthesis,…
Q: is the plant cell (green) and onion root (violet) the same cells? why or why not? explain the…
A: Plant cells are eukaryotic cells that have a genuine nucleus, and other progressive membrane-bound…
Q: Draw a labelled diagram of chloroplast.
A: Answer: Introduction:Chloroplast is green in color present in the leaves of most of the plants and…
Q: What are the parts of chloroplast?
A: The chloroplast is a double membrane-bound organelle. It is present in algae and plants. It contains…
Q: Why do chloroplasts move?
A: Chloroplasts are subcellular organelles (plastids) of plant cells generally considered to be derived…
Q: A biologist is looking at a cell sample under a microscope. They are able to observe mitochondria…
A: A plant eukaryotic cell is covered with the cell membrane and cell wall and has a proper Nucleus…
Q: Mitochondria and chloroplast have their own DNA and replicate separately from the nucleus and they…
A: The branch of science that deals with genetic material such as the genome, genes, DNA, and proteins…
Q: What are stroma in chloroplast?
A: Chloroplast is the cell organelles and are present in eukaryotic algae and plant cells. These help…
Q: Attempt to identify the single cup-shaped chloroplast containing the eyespot for phototaxis…
A: Chlamydomonas is a genus of single-celled, green algae. It consists of around 325 species. It is…
Q: How many external membranes are present in a land plant chloroplast?
A: Chloroplast membranes consist of about 45% protein and 55% lipid. It is an organelle mainly…
Q: Chloroplasts
A: Chloroplasts contains green pigment called chlorophyll. Parts of chloroplasts are : Thylakoid :…
Q: Although both organelles originated as free-living prokaryotes, mitochondria are significantly…
A: Cell organelles are defined as the specialized structures present within a cell for performing…
Q: How do scientists know that mitochondria and chloroplasts were likely once free-living prokaryotes?…
A: The mitochondrion and the chloroplast are both organelles that were once free-living cells. They…
Q: Chloroplasts and mitochondria are both unusual in that they have double membranes and contain their…
A: Chloroplasts and mitochondria are the organelles found in plants and animal cells. While…
Q: Which of the following cell components is not visible using a compound light microscope? a. Nuclei…
A: Both the plant cells and animal cells have some unique characteristics. The presence of plastids and…
Q: What is the function of chloroplast DNA?
A: Most of the eukaryotes contain DNA in their nucleus but some DNA is present within the mitochondria…
Q: True or False. Plant cells contain many of the same organelles as animal cells, with the addition…
A: Cell is the basic structural and functional unit of life. The cells structure and shape are…
Q: Outline in words the process of chemiosmosis in a chloroplast
A: Chemiosmosis is defined as a process in which there is the movement of ions (especially Hydrogen…
Q: If you were the professor reading that essay answer, what sort of grade would you assign, and why?
A: When students are asked to write an essay explaining how to distinguish between an animal cell and a…
Q: Survival of a eukaryotic cell without mitochondria is feasible, why?
A: Eukaryotes are organisms whose cells contain a nucleus and other membrane-bound organelles.
why is chloroplast called a kitchen of the cell? (a detailed and longer explanation is needed)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- True or False: Chloroplasts are ALWAYS very small compared to the size of the cell.The autophagosome fuses with an endosome to form a(n) _____________.A researcher interested in investigating the genetic relationship of mitochondria to bacteria must decide on the best method to study this. What advice would you give the researcher?
- vvIn contrast to the eukaryotic cell, the prokaryotic cell ischaracterized by the lack of a ____________________.These are all plant cells. Why don't they all contain chloroplasts?The image below shows a density gradient centrifugation carried out to separate a mixture of lysosomes, peroxisomes and mitochondria Organelle mixture 60L 1.11 Centrifuge 1.15 2 1.19 1.22 1.25 Which fraction would you take to obtain mitichondria, and why? O Fraction 2 because mitochondria contain haemoglobin. giving them a reddish colour O Fraction 3 because it is the most dense fraction O It is impossible to decide without further testing O Fraction 1 because it is the least dense fraction O Fraction 2, because mitochondria contain haem, giving them a reddish colour Increasing density of sucrose (g/cm³) 3.
- Can the Eukaryotic Cell (Animal) shape enclosed in the circle with all the shape's markings be drawn by hand? Note: The drawing should look like a student drawing, not an expert drawingTrue or false: A cell's identity is fixed and can not be changed.From what organelle is this DNA isolated? ATCACGAGCTTAATTACCATGCCGCGTGAAACCAGCAACC Use BLAST to discover what the genus and species is and read the description of the first organism that is listed. mitochondrion chloroplast ribosome nucleus
![Biology Today and Tomorrow without Physiology (Mi…](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
![Biology Today and Tomorrow without Physiology (Mi…](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)