Which of the following will have an electron configuration ending with 4p? Choose ALL that apply. d. Rubidium Atom a. Bromide lon b. Bromine Atom c. Krypton Atom e. Rubidium lon f. Selenide lon

Q: What does sterically hindered means? How do i identify it given a chemical figure? Please show…

A:

Q: (b) Draw the open, Fischer and Haworth Structures of glucose Q 03 (а) How hydrolysis of cellulose…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: QUESTION 55 The likelihood that the longer elution times (Rf) were due to the following: O The more…

A: As per our guidelines, I can answer only first question. Because you have posted multiple questions.…

Q: help please answer in text form with proper workings and explanation for each and every part and…

A: Part 2: Explanation:Step 1: Understand the experiment.The experiment measured the activity of…

Q: What amino acid substitution would be accompanied by the largest decrease in enteric water penalty?…

A: Amino acid along with ionizing sie chain ,such as asp, glu, His, liz, impart important properties to…

Q: Draw the structures of the products formed by hydrolysis of the following tripeptide at…

A: For the given tripeptide Gln-Val-Ser (glutamine-valine-serine) hydrolyzed at physiological pH, the…

Q: Please answer all questions. Give virrect structures for the substrate(s) and give the reaction…

A: Here we have to synthesize the given target compound 1-bromoethylbenzene from ethyl chloride in…

Q: Consider the tripeptide phenylalanylcysteylmethionine. Part: 0/2 Part 1 of 2 Draw the structure of…

A: Peptide structures are written in such a way that left side is N-terminal while right side is…

Q: In polarimetry when lactic acid measured was contaminated with glycerol, what happens to the…

A:

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: Using alanine as an example, draw possible conformations of alanine in a peptide chain (Ala-Met-Thr)…

A:

Q: 8. The following proteins represent a wide range of molecular weights and isoelectric points. Mr is…

A:

Q: Proteins are made from chains of amino acids. The amino acids are joined together by structures…

A: The structure of the dipeptide that is formed from two glycine molecules at the pH of most body…

Q: How many stigma bonds are in CH3CH2CH2SH?

A: Given, The structural formula = CH3CH2CH2SH The compound name of the structural formula CH3CH2CH2SH…

Q: Using proper convention, provide the amino acid sequence for the following protein. 19 BE BEL 301 ||…

A: Using the proper convention, provide the amino acid sequence of given protein:

Q: 1-proteins-lab-manual?module_item_id=44333 A= abc Where "A" is absorbance, "a" is molar…

A: First question had been answered. Absorbance of a solution can be calculated using Beer Lambert law.

Q: A polypeptide is ... O None of the above. O an addition polymer of amino acids O a part of nucleic…

A:

Q: 46. The phosphodiester linkages in DNA and in RNA are, respectively: a. 2' to 3', 3' to 2' b. 2' to…

A: DNA and RNA are nucleic acids.  In both phosphodiester linkage is present .

Q: Identify an amino acid that complies with the following characteristic: (Write the COMPLETE name)…

A: Amino acids are molecules that combine together to form proteins. These are a group of molecules…

Q: draw the dipeptides of Thr-Ala and circle the peptide linkage

A: We have to draw the dipeptides of Thr-Ala and circle the peptide linkage

Q: Classify the following characteristics as a type of 3D protein structure. Primary, Secondary…

A: From given structures It is matched with each of the specific component and function accordingly as…

Q: Classify the following as a lipid, carbohydrate, or amino acid: (EOCQ 58) CH,OC(CH,)1,CH, а.…

A: We are authorized to answer three subparts at a time, since you have not mentioned which part you…

Q: How many fused rings are there in steriod?

A:

Q: 6. You are designing a protein, which needs to be stable at high temperatures. Which amino acids…

A: Amino acids are the monomeric units that are used in the synthesis of protein molecules. There are…

Q: 2. a. Which amino acid is this? (might need to look at another amino acid b. Label which of these is…

A:

Q: If an association between an exposure and an association is differs significantly in strata of a…

A: 1. Answer - Given statement is true . Explanation -  The effect or association between an exposure…

Q: The below molecule of mannose is the [Select ] anomer. A glucose molecules used to my cellulose…

A: Beta glucose( group on 1 ,6 position are on same side) see in below attached figure. is the monomer…

Q: Fill in the side chains (including stereochemistry) on the dipeptide backbone below to make the…

A: All the amino acids exhibit L-stereochemistry except glycine.

Q: n one. Match enzyme or molecule with its function in bacteria. Answers may be used more than once or…

A: 37. RNA polymerase is the main enzyme in catalyzing DNA→ mRNA transcription.  38. DNA helicase…

Q: 2N N H H NH NH O

A: Given is organic compound.The name of given compound is Macimorelin.

Q: НОНН С. H,N-C-C-N-C-C-OH НОСН CH;CHCH, HOH H O TITT I H,N-C-C-N-C-C-OH d. H.NCH.CH.CH.СHН H

A: Amino acids are building blocks of proteins. they're concerned with many chemical and biological…

Q: Sketch the structure of a tripeptide composed of D-glucose, D-mannose, and D-galactose (in that…

A: Tripeptide are essentially consists of three amino acids which are linked together by forming to…

Q: Can you please draw me two versions of the dipeptide tyr-phe that represent the two resonance forms…

A:

Q: Draw the structure of the dipeptide Lys-Pro that is predominant at pH 8. Include all of the atoms…

A: To draw the structure of a dipeptide Lys-Pro that is predominate at pH equals to 8.

Q: Glycogen is a branched-chain polymer of α-D-glucose units in which the chain is formed by C1—C4…

A: Polysaccharides contains large number of monosaccharide units joined together through glycosidic…

Q: C) NUCLEIC ACID Sketch the general structure of a nucleic acid monomer and name all characteristic…

A: Since , you have posted question with multiple sub-parts , we will solve first three sub-parts for…

Q: primarily using 2. A protein is a polymer of amino acids that assume a unique structure in space…

A: To circle and describe the key IMFs in the given protein structure:

Quantum Chemistry

Quantum chemistry deals with the properties of chemical systems and their reactions. The branch of chemistry which is more concerned with quantum chemistry is physical chemistry. It is a more sophisticated field of theoretical physics which is concerned towards the application of physical concepts towards various chemical aspects such as, formation of atoms, chemical structure descriptions, chemical bond strength, hybridization, conjugation etc. Quantum chemistry mainly studies the various states i.e., ground state, excited state, transition states of the individual atoms or molecules taking place during any chemical reaction. The laws of motion explained by various scientists, which are termed as “classical mechanics” were not acceptable in terms of electrons, protons, atoms, light etc. Thus, a new theory named “quantum mechanics” emerged to understand the basic framework of various atomic and subatomic particles.