Which of the following valves are open and which are closed during systole of the ventricle? a) Pulmonary semilunar b) Aortic semilunar c) Mitral d) Tricuspid

Q: Which group of people  ( race, age, sex, socioeconomic history ) were chosen in the Tuskegee study?…

A: Tuskegee study of Untreated Syphilis in 1932 to 1972 . It is the "most infamous biomedical study in…

Q: Who is Joset Breuer ?

A: The study of the mind and behavior of an individual is referred to as psychology. Various techniques…

Q: write about mitochondrial DNA.

A: Mitochondrial DNA is a circular double-stranded DNA composed of heavy and light chains ,which…

Q: Describe the lock and key model(use a drawing to illustrate and a description thereof)

A: Enzymes have a strong level of specificity to their substrate. To help accelerate a chemical…

Q: Please identify the two muhsrooms attached in the picture

A: In first picture given mushroom is MYCENA LEAIANA

Q: The solution was graded as incorrect in my homework. Is there another option for this question?

A: Infectious diseases are illnesses caused by pathogenic microorganisms such as bacteria, viruses,…

Q: an example of creating de-identified notes or teach me how to make one

A: De-identified notes are reports or records that have had actually recognizable data (PII) eliminated…

Q: watch the four minute video: https://www.youtube.com/watch?v=B-nEYsyRlYo  Anwer this question:What…

A: It is very important to value life and not only our life but also the life of other living beings.

Q: Hello, Can you please help me to find the next question about San Diego? (if it is posible, the…

A: Approach to solving the question: Detailed explanation: Examples: Key references:Anthropology

Q: Which is the correct answer. I don't see it in your response.

A: The propagation of nerve impulses from one neuron to the next neuron occur at the synapse. The axon…

Q: how long is the wait for the answer

A: Absorption is the process whereby molecules are taken up by cells from the extracellular fluid and…

Q: .Choose the correct sentence Does you have much sugar? We used noun phrase in the place of noun to…

A: Figure of speech It refers to the deviation from standard usage of words in order to improve their…

Q: Andrea is flushed and her teeth are chattering even though her bedroom temperature is 72°F. Why do…

A: When a person is flushed it means that the person turns red as they are ill or hot due to a strong…

Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu…

A: RNA molecules are formed with the help of template DNA strand in the process transcription with the…

Q: info

A: A blood clot in a vein causes a condition known as venous thromboembolism (VTE). Deep vein…

Q: For what I have filled out, is it correct? For the stuff not filled out, what are the answers?

A: Sir Gregor Mendel was a priest and a teacher who did the famous hybridization experiment on garden…

Q: _cells stimulate both arms of the immune response (one arm is self and the other arm is foreign)

A: According to guideliness we have to answer the first question only so please kindly post the 2nd…

Q: The binding of a _______________ and its __________________ initiates the particular event or series…

A: The binding of a ____LIGAND___________ and its ______RECEPTOR____________ initiates the particular…

Q: you did not provided the whole worksheet

A: Asexual reproduction involves only a single parent while sexual reproduction involves two parents as…

Q: What I want to know is where is the information from so I can make citations. Thank yo

A: Loss of effectiveness of a vaccine after a certain duration of time is called waning immunity. It is…

Q: 2. DNA Sequence: TAC TCC GGC TCT CcC AGT TGA ACT Mutated Sequence: TAC ICI GGC TCT CCA AGT TGA ACT…

A: Let us first convert the 3' to 5' DNA sequence into 5' to 3' mRNA sequence and will then translate…

Q: Is it possible to get this typed

A: Introduction Antibiotics are the compounds that are used specifically to target and kill bacteria or…

Q: Please choose answer(s) from the three at the bottom of the question

A: Introduction :- True breeding, also known as pure breeding, refers to a population of organisms…

Q: Specific prevention. Exists or not. Briefly explain why.

A: A virus is defined as an infectious microorganism made up of a protein-coated segment of nucleic…

Q: A ALEKS - Julianna Graham - Lex ← -> +…

A: To predict the percentage of DNA that is radioactive after each experiment, we need to understand…

Q: Control Periods of oestrus Experimental 20- 18- 16- 14- Experimental, 12- 10- 8 6- Control Jun Aug…

A: Oestrous Cycle also known as estrous cycle is the sequence of reproductive and physiological changes…

Q: write about cytochrome p3A4 enzyme .

A: Cytochromes are the enzymes that contains heme as a cofactor. They helps in oxidizing steroids and…

Q: SAM is the abbreviation for ____________________.

A: SAM is a natural naturally-occurring compound found in almost every tissue and fluid in the body.…

Q: The solution ended up being incorrect on my homework. What would be another option?

A: A communicable disease is one that may be spread from one person to another or from an animal to a…

Q: In our laboratory experim fermentation of glucose oxidation of sulfur reduction of sulfur…

A: Answer. Respiration is the oxidation of respiratory substrates such as glucose and fats.…

Q: a. What is the article about? b. When did this happen? c. Where did it take place? d. Who is being…

A: a. What is the article about?This article mentions about cases of hepatitis in children. It talks…

Q: The __________ has the appearance of a cluster of grapes.

A: The respiratory system is responsible for the exchange of gases between the environment and the…

Q: kickboxer is training for an upcoming MMA fight. After running 5 miles he experiences painful cramps…

A: * Here afternoon running five miles the kickboxer experience the cramps in the quadriceps. * During…

Q: what is chronological order

A: When we are arranging events, we tend to arrange them in order. This order helps us to understand…

Q: Please help urgently with the complete answer of this question asap

A: Proteins are biomolecules are made of amino acid monomers. Amino acids are joined together by…

Q: O Introduce your scenario/context- coast to coast O Define homeostasis and thermoregulation and the…

A: The highlighted questions are four, as per the guidelines we can only answer the first three. Please…

Q: The word rotate means

A: KEY WORDS :- Spherical - Round in shape.