Which of the following statements about transcription in bacteria (prokaryotes) and eukaryotes is FALSE? Select one: O In bacteria, the RNA transcript is immediately useable as mRNA for translation; in eukaryotes, the RNA transcript is processed before translation. O In eukaryotes a polyadenylation sequence is added to pre-mRNA transcripts; in prokaryotes it is not. O RNA polymerase requires a primer in bacteria; in eukaryotes, it does not require a primer. O In bacteria, the RNA polymerase directly recognizes and binds to the promoter; in eukaryotes, transcription factors are needed to help the RNA polymerase to bind

Which of the following statements about transcription in bacteria (prokaryotes) and eukaryotes is FALSE? Select one: O In bacteria, the RNA transcript is immediately useable as mRNA for translation; in eukaryotes, the RNA transcript is processed before translation. O In eukaryotes a polyadenylation sequence is added to pre-mRNA transcripts; in prokaryotes it is not. O RNA polymerase requires a primer in bacteria; in eukaryotes, it does not require a primer. O In bacteria, the RNA polymerase directly recognizes and binds to the promoter; in eukaryotes, transcription factors are needed to help the RNA polymerase to bind

Name: Which of the following statements about transcription in bacteria (pr
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the following statements about transcription in bacteria (prokaryotes) andeukaryotes is FALSE?Select one:O In bacteria, the RNA transcript is immediately useable as MRNA for translation; in eukaryotes, the RNA transcript isprocessed before

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Which of the following statements is correct? Many prokaryotic, but not eukaryotic, mRNAs are polycistronic. Eukaryotic, but not prokaryotic primary transcripts undergo extensive post-transcriptional processing before becoming mature MRNAS. O All of the provided statements are correct. transcription and translation are tightly coupled (i.e., occur at the same time in the same place within the cell) in prokaryotes, but not in eukaryotes.
The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'
Which of the following characterize RNA polymerase Il transcriptional termination in eukaryotes? Endonuclease cleavage of the RNA transcript and 5' to 3' exonuclease activity a protein known as Ratl None of the provided answers, transcriptional termination occurs in prokaryotes. Recognition of the transcriptional stop codon by a release factor. Hairpin structure formation on the newly synthesized RNA molecule which disrupts the DNA-RNA hybrid at a poly-U RNA sequence Binding of the Rho protein.
The following fictitious double-stranded bacterial DNA sequence codes for a fictitious protein. Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. Transcription begins with and includes the red underlined A/T (top strand/bottom strand) base pair. This is a bacterial sequence, so there are no introns. 5'GTGTCCGTATGATATTGTGAGATGTTATATCCCGCCGTCAACACCATAAAACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC 3′ 3' CACAGGCATACTATAACACTCTACAATATAGGGCGGCAGTTGTGGTATTTTGTCCTAT TAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG 5′ a) Which strand is used as a template for transcription, the top or the bottom? b) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends. c) What is the translation of the first 15 nucleotides of the mRNA? d) Do the underlined nucleotides TAA encode a stop codon for the protein? Explain. e) A mutation occurs which results in the insertion of an extra G/C (top strand/bottom…
Which of the following mechanisms do prokaryotes use to produce different protein products from a single RNA transcript? O Transcribing three separate genes on a single mRNA Cleaving a polypeptide into three parts creating three distinct products O Utilizing site-specific recombination to generate three different versions of the gene O Utilizing alternative splicing leading to three distinct MRNAS
Which of the following processing events occur during or after the synthesls of MRNA molecules in eukaryotes? Intron splicing Addition of a 5'cap O Cleavage of multiple functional molecules from a larger precursor O Polyadenylation of the 3' end
Indicate which of the following items are associated with transcription or translation. This could be in prokaryotes or eukaryotes, or both. Group of answer choices: Translation OR Transcription Sigma binds to the promoter mRNA binds to the small ribosomal subunit Spliceosomes remove introns and splice together exons Nucleotides are added from the 5' to 3' end tRNA anticodon binds to the corresponding mRNA codon STOP codon results in termination
Which of the following sites would you predict to be present in the gene encoding a MRNA molecule and what would be their order? LIST OF SITES #1 Promoter #2 Ribosome Binding Site #3 Translation Initiation Site #4 Translation Termination Site #5 Transcription Initiation Site #6 Transcription Termination Site O 3, 1, 2, 6, 4, 5 O 1, 3, 2, 5, 6, 4 О 1,5, 2, 3,4, 6 О 1,3, 2,4 О 1,3,4
EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in prokaryotic translation. The sigma subunit of RNA polymerase is replaced by NusA to recognise the promoter region of a gene. The -10 and -35 sequences in E. coli DNA are referred to as untranslated region. In human, translation begins before transcription of an mRNA completes. this statement true or false.
Which of the followings indicate the order of procaryotic mRNA degreadation? cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme cleavage of the triphosphate 5′ terminus to yield a monophosphate- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- 3′ to 5′exonuclease digestion The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion
Match the statement that corresponds to the specific type of transcription and translation. Choices: Eukaryotic Translation Prokaryotic Translation and Transcription Both Prokaryotic and Eukaryotic Transcription Prokaryotic Transcription Prokaryotic Translation Both Prokaryotic and Eukaryotic Translation Eukaryotic Transcription 1. RF1 and RF2 recognize the three bases to terminate the process 2. TATA box in the promoter region 3. single mRNA codes for the proteome 4. methionine is removed 5. simultaneous and rapid process producing mRNA and polypeptide 6. eRF recognizes UGA 7. dozen of initiation factors involving methionyl tRNA * 8. rho factor and sequence of uracil in a loop conclude the process 9. ribosome propels to the next bases 10. sigma factor binds to RNA polymerase in the promoter region 11. regulating elements in the operon 12. cleaving the polypeptide by adding water 13. removal of gene segment disrupting the message 14. CAAT box is found 80 nucleotides from the…
Why would it be impossible for DNA splicing to occur utilizing the same mechanism as eukaryotic MRNA splicing? Spliced DNA could not be transcribed or translated DNA does not have a 3'-OH group for the initial nucleophilic attack that forms the lariat O DNA does not encode introns O DNA does not have a 2'-OH group for the initial nucleophilic attack that forms the lariat