Which of the following statements about polyadenylate polymerase is correct? O It is tethered to RNA polymerase II O It synthesizes a 80-250nt long stretch of adenines based on the DNA template O It is a DNA-dependent RNA polymerase O All of the these

Q: RNA polymerase transcribes the following DNA template strand: 5' ACC TTT CCG 3' What is the RNA…

A: Gene is the sequence of nucleotides that encode a particular protein.

Q: What is the function of the Primase enzyme?     To edit out primers at the end of DNA replication…

A: DNA replication: It is a kind of process in which the DNA makes multiple copies of itself during…

Q: What is the role of the DNA Polymerase I 5' --> 3' exonuclease activity at a replication fork? O…

A: DNA polymerase I is an enzyme which has 3 functional activities which are : 5'-3' polymerase…

Q: O mediator complex O histones RNA polymerase enhancer

A: Transcription is the process by which the information of a strand on the DNA is replicated by its…

Q: Coding strand of DNA, complimentary to the template strand 5' 3' A T G C T T G CA CATT G a GA A G A…

A: A molecule made up of two chains of a polynucleotide that generate a double helix by coiling around…

Q: The trpL sequence in the trp operon encodes O a poly-A tail addition sequence O rho termination…

A: Answer :- several codons for the amino acid trp  Because the in the  E. coli operon that is the…

Q: In the following diagram of a replication fork, primers are shown as thick black lines and newly…

A: The heterocatalytic process by which a new DNA stand is synthesized on a old DNA template is known…

Q: Primases     are DNA polymerases     are RNA polymerases that act in association with the helicase…

A: DNA primase is an enzyme involved in the replication of DNA

Q: Which of the following enzymes in E. coli synthesizes new DNA at sites of DNA damage during base…

A: The DNA repairing by the base excision repair and the nucleotide excision repair is done by the…

Q: Fill in the blanks in the following statements about DNA replication. 3' Parental strand 5' 2. Then…

A: “Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: If a person is lacking a gene that codes for a protein involved in nucleotide excision repair, then…

A: DNA can experience a variety of chemical reactions, as in any other molecule. However, since DNA is…

Q: Exonucleases can digest the poly A tail of eukaryotic mRNAs in the 3' to 5' direction which thereby…

A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…

Q: The following is the 'start' of a gene, the place where the RNA polymerase first starts laying down…

A: The gene is the part of a DNA that is usually undergo transcription and produce a specific RNA. The…

Q: The palm domain of a DNA polymerase O contains the catalytic site of the enzyme CIC Site

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: What mechanism will be used in the following dna changes a change in the structure of a base cause…

A: Introduction: DNA changes can refer to alterations to the genetic data stored inside the DNA…

Q: Polymerases synthesize nucleic acids in the DNA and RNA is in the directinon. Fill in the two blanks…

A: Polymerases are the enzymes that polymerise nucleic acids like DNA or RNA. DNA polymerase synthesis…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: Given:

Q: Explain why the following statement is true: RNA polymerase copies template DNA in the 3’ to 5’…

A: The DNA helix is unwound right before the active site for polymerization by the RNA polymerase,…

Q: what is the Role of ATM in the cell and cancer ?

A: ATM gene which stands for Ataxia-Telangiectasis Mutated gene is a gene which is responsible for…

Q: Telomerase adds nucleotides to the O 5' end of the parental strand O 3' end of the daughter strand O…

A: Telomerase, likewise called terminal transferase, is a ribonucleoprotein that adds an animal types…

Q: DNA polymerase III adds nucleotides to both ends of the RNA primer to the 5' end of the RNA primer

A: DNA is the genetic element found in all prokaryotic and eukaryotic cell types. DNA is a…

Q: Which of the following is correct about transcription?    options:   The reaction is driven…

A: Transcription  It is the process of synthesis of pre mRNA from DNA.

Q: Which process is illustrated in the diagram? ws Replication Transcription RNA processing Translation…

A: DNA replication is the process by which a cell duplicates its DNA before cell division. The…

Q: RNA polymerase is associated with which of the following processes

A: Introduction:- RNA polymerase is an enzyme that assists in the transcription process by copying a…

Q: Which of the following statement(s) correctly describe(s) telomerase? Select all that apply. You may…

A: DNA replication is heterogathetic process by which a new DNA stand is synthesized on the old DNA…

Q: Which one of the following is true of DNA polymerase, based on our coverage? The 2'OH of the dNTP…

A: DNA is the genetic material of most of the organisms. DNA polymerase has important role in DNA…

Q: In mammalian cells polymerase ε  replaces polymerase III for elongation. True or false In mammals,…

A: Introduction  Polymerases are a group of enzymes that catalyze the polymerization of nucleotides…

Q: Which of the following is/are required for RNA synthesis? (sel

A: RNA synthesis is made from the DNA molecule. so RNA synthesis is the synthesis of RNA like mRNA from…

Q: *Replication bubble and position of O. fragments. restriction enzyme rho-dependent termination

A: Asp per the guideline we are allowed to answer only starting 3. Please repost the rest.

Q: RNA synthesis in eukaryotes and prokaryotes O occurs in the 3' to 5 direction. O none of the choices…

A: The synthesis of RNA is also known as Transcription. It is the process of converting or transcribing…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.