Q: Can you please explain why each is teh way it is, not just what they are.
A: The lac operon is found in the bacteria where the presence of lactose and glucose can on and off the…
Q: 13. SpongeBob SquarePants recently met SpongeSusie Roundpants at a dance. SpongeBob IS heterozygous…
A: Answer : Based on the Punnett square provided, probability for each genotype and phenotype are as…
Q: UUU UUC UUA UCU) UCC UÇA UCG UAU Tyr UACS Phe UGU U Ser UGC Cys UUG Leu UAA Stop UGA Stop A UAG Stop…
A:
Q: Check All That Apply As exposure to X-rays increased, the ratio of type 1 to type 2 outcomes…
A: 1. What results did muller obtained? ANSWER: The explanation for the aforesaid experiment is given…
Q: 27. While culturing some cells, you lower the temperature of the culture. What happens immediately…
A: Cell membrane are composed of lipid bilayer and proteins. Membrane fluidity depends on the content…
Q: 6. Compare the size and shape of plant and animal cells. 7. Compare the size of plant and animal…
A: Answer 6 : the difference betweeen plant and animal cells are : 1) plant cell have a specific shape…
Q: The dorsal
A: The diagram represents the cross section of the spinal cord. The spinal cord is part of the central…
Q: The graphs below show the size of three populations over time. Which population is NOT currently…
A: Carrying Capacity is defined as the maximum number of individuals that an environment is able to…
Q: A B C D E F G Use the following tree to answer the question below. Which of the following trees, if…
A: A phylogenetic tree is defined as a branching diagram or tree that depicts the relationships that…
Q: Organelle Plant/Both Nickname Explanation
A: Introduction Cell organelles are the subcellular structures that are allowed for performing specific…
Q: 1. What are the main structural features of the polysaccharides starch? 2. How do this aids in its…
A: Starch is the primary carbohydrate source for growing seeds and for the development of leaf tissue.…
Q: Sex is the combining and mixing of _during the formation of offspring. It involves two main…
A: REPRODUCTION:- It is the production of offspring from the parents. It is of two types:- 1)Asexual…
Q: DNA fingerprints are highly individual-specific and only applied to solve parental disputes. Lütfen…
A: DNA fingerprinting occurs in four steps. extraction, quantitation, amplification, and capillary…
Q: Characteristics Porifera Cnidaria Platyhelminthes Mollusca Level of organization Symmetry…
A: As per our company's guidelines we are supposed to answer three sub-parts only please repost the…
Q: Translation starts at the codon. The TRNA brings in the correct to the ribosome, matching the on the…
A: Note: Please Cross Check The Last Fill In The Blanks, Due To Half Image I wasn't Able to figure out…
Q: c) The signal recognition particle (SRP) plays an important role in bringing proteins to the ER.…
A: (a) Protein A is the transmembrane protein. Transmembrane proteins are the proteins which are…
Q: Genetic diversity is always introduced during a) sexual reproduction. b)vertical gene transfer.…
A: Genetic diversity is the total number of genetic characteristics in the genetic makeup of a species,…
Q: An Ap-horizon is formed by the plow 1. True 2. False
A: Soil horizons are the different layers of soil present in soil profile.
Q: What is the infectivity of the new influenza strain? Infectivity: number of people infected divided…
A: Hi, Thanks For Your Question. Answer : Correct Option Is A (63%)
Q: WHICH IS THE BASE AT OFFSET 5 OF GATTACA. LEFTMOST BASE HAS OFFSET 0.
A: Base offset is an addressing scheme that allows the CPU or any other man or machine to start…
Q: Eukarya ked," i.e., devoid of proteins, therefore not omatin (= DNA + histone proteins) and not | by…
A: Prokaryotic cell arw simple cells which are devoid of nucleus and many organelles whereas eukaryotic…
Q: Repeat these replication questions again, this time the replication bubble has been flattened out…
A: Replication is the process of providing two copies or exact replica of entire genome. Primer is a…
Q: State five (5) different countries with one influence from each on the philippine popular culture.…
A: Many different countries have different cultures which define their diversity vividly. It is the…
Q: 1) New nucleic acids are made 5' to 3'! 2) Base paired strands are antiparallel. Apply this…
A: One of the two DNA strands present at the replication fork, known as the leading strand, replicates…
Q: Nif gene means nitrogen fixation gene. Lütfen birini seçin: O a. True O b. False
A: The nif genes are found in both free living nitrogen fixing bacteria and in symbiotic bacteria in…
Q: This layer is sandwiched in-between layers of muscle. lumen This layer may be composed of…
A: The gastrointestinal tract is in the form of a muscular tube which is having a lining of mucous…
Q: writing this in ApA with good credible sources or on given above
A: The author's knowledge and the vetting criteria of the publishing house are two signs of…
Q: A white-eyed female fruit fly X"XW is crossed with a red-eyed male XW*Y. Select all of the viable…
A:
Q: of eukaryotic cellular processes llowing processes take place. Bl
A:
Q: 5'-GUCAGCAU-3' but i need help understanding why is it.
A: Introduction In the majority of species, genetic information is stored in DNA. Each human cell has…
Q: H3C N. H3C CH3 он CH3
A: This molecule contain one hydroxyl group and one amino group, otherwise the rest of the molecule is…
Q: Procedure: • Pull down the rubber sheet. What happens to the balloons? the human which causes the…
A: Breathing is an involuntary process. It aids in carbon dioxide elimination and oxygen delivery. The…
Q: Which of the following best describes this photo
A: The picture is showing that the pot is in the slant position. The shoot consisting of leaf and stem…
Q: 12. Fill in the blanks with the best answer from the list below. Answers are used only once, but not…
A: G protein coupled receptors are present on the membrane. It binds an extracellular signal there by…
Q: Introduce your scenario/context- coast to coast O Define homeostasis and thermoregulation and the…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: Down 1 Mutations that lead to a premature stop codon being inserted into an mRNA and shortens the…
A: 1. Nonsense (mutation) 2. Nucleotide 4. Oligonucleotides 6. Polymerase 7. Silent (mutation) 8.…
Q: Correctly order the steps of excitation contraction coupling for a muscle fiber. 1. 2. 3. 4. 5. 6.
A: The human body is a plethora of fascination. There are different organ systems that function in the…
Q: What is a response element? A response element is a sequence of help in gene (DNA or RNA) that binds…
A: Hi, Thanks For Your Question. Answer : What is a response element? 1. A response element is a…
Q: 1) New nucleic acids are made 5' to 3'. 2) Base paired strands are antiparallel. Apply this…
A: DNA replication a phenomenon in which DNA itself function as template for making new daughter…
Q: 96. Which one of the following is the correet match of the site of the action on the given…
A:
Q: Spaced practice question: Which of the following statements is accurate concerning respiratory…
A: In the body, respiratory alkalosis condition when there exists a disturbance in the balance between…
Q: 1. Schizophrenia
A: Schizophrenia is a chronic and severe mental disorder that alters the ability of an individual to…
Q: 9. In human beings, the gene for red-green colorblindness (r) is sex-linked and recessive to its…
A:
Q: Match the evidence of evolution with its description: f Comparative Anatomy a. structures that don't…
A: Comparative anatomy - comparin strucrures to show species has shared ancestry. Homologous organ -…
Q: 2. The largest population an ecosystem can support is the carrying capacity determine by the which…
A: Ans: 2 Carrying capacity, limiting factors Explanation: The largest population an ecosystem can…
Q: parts name only of the illustration from the given set of choices asap thanks
A: The diagram that is shown in the image is the female reproductive system. The question asks to label…
Q: Put the trophic levels in order such that (a) likely has the lowest concentration of mercury. apex…
A: Introduction :- In natural environment , organisms are categorised into different trophic levels…
Q: Help label the 2 pictures
A: The brain is a remarkable three-pound organ that regulates all bodily functions and analyzes…
which of the following is not suffix of GATTACA?
1 CA
2 TTACA
3 GATT
4 A
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- O CH₂-O—C—CH₂(CH2)13CH3 O 11 CH-O-C-CH₂(CH₂)13CH3 1 CH, O R + -0 0-CH₂CH₂NH3 O–CH,CHÍNH, >=0can you make this correct activity seems they are wrong pls answer correctly by following the instructionSecond letter C UUU UGU UGC. UUC Phe UUA UUG UCU UCC UCA UCGJ UAU1 UAC. Ser UAA Stop UGA Stop A Tyr Leu UAG Stop UGG Trp CAUTHIS CACS CAA GIn CAG CGU CGC Arg CCU CUU CỤC CỦA CUG J CC Leu Pro ССА CGA CCGJ CGGJ AGU Ser ACU АСС ACA AUU AAU Asn AAC AAA AUC le AGA TArg Thr AUA AUG Met ACG AAGLYS AGG GAU GUU) GUC GUA GUG GCU) GCC GCA GACASP GAA AGlu GAGS GGU GGC Gly Val Ala GGA GGG GCGJ Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' Third letter UCAC UCAG UCAG UCAG 등 | First letter
- In UMN lesions the response of the paralyzed muscles to electrical stimulation is :-a- exaggeratedb- inhibitedc- not changedd- is absentChoose a match tion 13Normal Blood O Levels Increasing the levels of in the blood Deciining levels in the bicod Increasing the production of Signals the Which acts upon tha which releases the homone balagycomer com Image from Biologycomer.com
![Medical Terminology for Health Professions, Spira…](https://www.bartleby.com/isbn_cover_images/9781305634350/9781305634350_smallCoverImage.gif)
![Medical Terminology for Health Professions, Spira…](https://www.bartleby.com/isbn_cover_images/9781305634350/9781305634350_smallCoverImage.gif)