Spell drug names 1. Spell CAR-de-zem 2. Spell di-ah-BEN-eze 3. Spell FEE-a-sol 4. Spell NAP-ro-sin 5. Spell LIP-a-tour 6. Spell LAY-six 7. Spell Eye-bu-PRO-Fen 8. Spell die-AS-a-pam 9. Spell TEN-or-min 10. Spell aug-MEN-tin
Q: CATEGORY 2: DRUGS USED FOR PEDIA PATIENTS (ANY OF NEWBORN, PRETERM, FULL TERM ) 10 R's TO MEDICATION…
A: Erythromycin- This drug acts as an Antibiotic. This type of antibiotics are generally used for the…
Q: ONo.21: A 22 years old female visits the doctor for extreme exhaustion and tiredness at hed timeshe…
A: Insomnia - It is a condition in which person faces problems in falling asleep and is unable to sleep…
Q: Write short note or summary on the given topics: 1. Biological half- life of drug please…
A: A medication's biological half-life refers simply to how long it takes for half of the dose to be…
Q: OH 1 ОН F 12 H H CH2 нно CH3 || 5 C 4 7 8 C-N 10 - CÉC C-N-cc2 | - | || | || но CH3 H. нно CH2 11 13…
A: Ans - Peptide bonds are the bonds formed by condensation of carboxyl group of one amino acid with…
Q: 5 oz po day 1, then 3 oz po days 2-7 How many milliliters should the pharmacy dispense
A: Drug Medication has physiological effect and causes significant changes in the body. Factors…
Q: Capital Campaign for Opiods Addiction
A: Narcotic Awareness Campaign and Education In 2020, there were 411 excess passings that elaborate the…
Q: ABG RESULT INTERPRETATION PROBABLE CAUSE(S) RT INTERVENTION Na* = 145.9 mEq/L Ca**= 4.9 mEq/L Cl =…
A: ABG (Arterial blood gas) is a test that is used to measure the level of arterial gases such as…
Q: crude Leaves of Digitalis are not affective drug ? Select one: True False
A: Digitalis is a type of drug that is extracted from many plant groups called the foxgloves. It…
Q: Can you state two more examples for consumers or for you when you enter your medical profession?
A: An adverse or side effect of a drug substance is the chemical reaction initiated after consuming or…
Q: CREATE A SOAP NOTES OUT OF THIS CASE Chief Complaint “I just moved to town, and I’m here to see my…
A: SOAP analysis is the method analyzing case based on subjective, objective ,assessment and Planning.…
Q: D Lora zep am CAtiva) Po it is avail able in 0.5mq tablets. your client has been ordered O:75mq of…
A: Lorazepam is a benzodiazepine medication that is used to treat several psychological and…
Q: Sleeping under a tree at night is not advisable. Comment.
A: Plants, in the presence of sunlight, carries out photosynthesis to produce glucose and oxygen from…
Q: what is antimicrobal PDT explain how it has influenced dentistry and other forms of antimicrobal…
A: Note: Please note that as per our company's honor code we are not allowed to cite external…
Q: A B H D E E D ...... F K G B ..... H L A. M M ....
A: A microscope is an instrument that helps in observing the microscopic organisms or structures that…
Q: I just need A full report on this new drug called (camzyos) and effects .
A: Reduced blood flow to body parts is a result of the chronic, progressive condition known as…
Q: Ceruloplasmin contains - Zn B Cu Fe
A: Many enzymes contains micronutrients as a cofactor . some of the micronutrients are - Cobalt,…
Q: Black Box Warning for fatal respiratory depression in opioid analgesics M-morphine O-oxymorphine…
A: Optics are the drugs basically found in the poppy(opium) plants. It has a analgesic effect of…
Q: 21 PS 2F ZS E 22
A: This picture is of Cell division (Anaphase) Mitosis is a type of cell division in which a cell…
Q: THE QUOTE IS: "THE FOOD YOU EAT CAN BE EITHER THE SAFEST & MOST POWERFUL FORM OF MEDICINE OR THE…
A: The goal of food safety is to keep risks to a minimum. An effective national food control system is…
Q: What is the antidote of morphine?
A: Morphine is an extremely powerful painkiller. It is one among a variety of compounds termed opioids…
Q: H;C. NH QH HO-P=0 ÓH A True B) False
A: Thymidilic acid is a part of DNA. It is exclusively found in DNA and not in RNA. Thymine is a…
Q: 1 week meal plan bipolar patients
A: 1 week meal plan bipolar patients:
Q: 7. Explain about capsule ?
A: The capsule is the protective structure in various microbes like bacteria and fungi. It's a kind of…
Q: UNSCRAMBLE THE WORDS 1. ( M C A L R A G D O ) 2. ( B E Y O L M R O Y G ) 3. ( N E T A P Y O G O L…
A: The study of links between various groups of species and their evolutionary development is known as…
Q: XM CualtricX Asessm X GWhat sh x O Micrse X 6 Mot- M x translat X JOVSLYaKWzue2 IDENTIFYING HAZARDS…
A: The list of hazards that I can recognise from the above image: Bystanders Cigarette Broken glass…
Q: Write short note on the given topics: 1. Bioavailability of drug
A: Pharmacokinetics and pharmacodynamics are two terms important in pharmacology. These two help to…
Q: 1) Lorazepam CAtivan), Po. it is aNarlable in O•5 mq tabiets - your eliernt has been ordered 1 mg Of…
A: The five major phases of a nursing process include assessment, diagnosis, planning, implementation,…
Q: 3. A's go with A's T's C's O G's
A:
Q: After analyzing the above pictures, identify the reasons for drug instability when kept at this…
A: Drug stability indicates the capacity of the drugs to maintain their structural, pharmacological,…
Q: I am finding it difficult to formulate a SMART goal that will be used for a health promotion program…
A: The health promotion model has been developed to be a “complementary counterpart to health…
Q: Q: What is Dextran?.
A: Polysaccharide is composed of different types of monosaccharide units bound together by glycosidic…
Q: These are just some examples of consumer drug laws. Can you state two more examples for consumers or…
A: Drugs are the chemical compounds when entered into the body being physiological changes. Drugs that…
Q: 3 1 7 2.
A: Bone is a mineralized connective tissue that displays four types of cells including osteoblasts,…
Q: glatiramer acetate
A: Name of the drug is: Glatiramer Acetate Uses: It is an immunomodulator drug used against auto…
Q: 12 14 15 18 17 23 19. 16. 16
A: Spinal cord is a long tubular structure of the nervous system that arises from brainstem and extends…
Q: Q.No.33:-khas khas is:- a) Alcohol b) Opium c) Dhatura d) Strychnine e) Castor oil
A: Drugs are basically medication which are used to treat physical illnesses , mental disorders . This…
Q: While working on your homework for this course and surfing the Internet to check out all the…
A: Office of Inspector General (OIG) seeks about 150 fugitives that are charged with fraud and abuse…
Q: rite a note on Clearance of Drugs from the body? Please write at your own easy words.
A: Drug clearance can be defined as the plasma volume in the vascular compartment which is cleared of…
Q: n Clearance of Drugs from the body? Please write at your own easy words
A: Clearance is a rate that is defined as the amount of plasma free from the drug in a time period. It…
Q: Please show all 4 crosses. Thank you 1) YYSSxyyss 2)YySSx yyss 3) yySs x yyss 4) YySs x yyss…
A: A cross between two parents differing in two pairs of contrasting characters is known as dihybrid…
Q: T7Q यदि AA= 10 एवं aa = 0 है तो अति प्रभाविकता का उदाहरण होगा ? (1) Aa = 5 (2) Aa = 7 (3) Aa = 10…
A: Answer :- जब दो विपर्यासी लक्षणों का आपस में काम कराते है तो, F1 , पीढ़ी में प्रभावी तथा अप्रभावी…
Q: G. Н. I. J. K. L. М. N. (Choose) (Choose) (Choose) IChooco] >
A: Microscope is an instrument which is used to observe objects that are invisible to the naked Eye.…
Q: 14- 13- 12- 11 10- 15 Co 나 16 17 18 19 20 21 -3 1 -2 -5
A:
Q: The drug premarin is found In scored tablets of l,25ma. Irug ordered is Premarin 312.5mcg Huw much…
A: According to the condition of the patient, the doctor will prescribe the dosage.In the prescription,…
Q: xylin is a fast clearing agent penetrate the tissue and cheap O true O false
A: Clearing is required to remove alcohol from tissues and is replaced by fluid which is miscible with…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Second letter C UUU UGU UGC. UUC Phe UUA UUG UCU UCC UCA UCGJ UAU1 UAC. Ser UAA Stop UGA Stop A Tyr Leu UAG Stop UGG Trp CAUTHIS CACS CAA GIn CAG CGU CGC Arg CCU CUU CỤC CỦA CUG J CC Leu Pro ССА CGA CCGJ CGGJ AGU Ser ACU АСС ACA AUU AAU Asn AAC AAA AUC le AGA TArg Thr AUA AUG Met ACG AAGLYS AGG GAU GUU) GUC GUA GUG GCU) GCC GCA GACASP GAA AGlu GAGS GGU GGC Gly Val Ala GGA GGG GCGJ Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' Third letter UCAC UCAG UCAG UCAG 등 | First letterThe drug below is used in the treatment of: Rheumatoid arthritis. O Gram(+) bacterial infections. O Herpes simplex infections. O HIV. O Cancer. Aco OAC OAC OAC $-Au-P(C₂HalsSecond letter UUU UUC UUA UUG. UCU UCC UCA UCG UAU Tyr UAC. Ser UAA Skp UGIA Stop UGU UGC. Phe Cys Leu UAG Sop UGG Trp CGU CGC Arg CGA CCU CAU CUU CUC CUA CUG His CAC CAA CAG Gin CCC Pro CCA Leu CCG CGG ACU AAUA AGU ]Ser AUU Asn AAC AGC AGA LArg AGG. AUC Be ACC ACA Thr AAA AUA AUG Met ACG MGys GUU GUC Val GUA GCU GCC GCA GCG Ala GAA Glu GAG GAU GAC Asp GGU GGC Gly GGA GGG GUG You come across four polynucleotide strands. The first is an original RNA strand that codes for a protein; the others are similar to the original RNA strand, except that each displays a point mutation. The point mutations are shown in red. 5' - AUG-UGC-AUU-CCU-GCA-UAA - 3' 5' - AUG-UGA-AUU-CCU-GCA-UAA - 3' 5' - AUG-UGC-AUU-CCC-GCA-UAA - 3' 5' - AUG-UGC-GUU-CCU-GCA-UAA - 3' Original RNA: Mutant RNA 1: Mutant RNA 2: Mutant RNA 3: 1. Based on how they will affect the protein product, identify the type of point mutation (missense, nonsense, silent, or frameshift) present in the Mutants 1, 2, and 3. 2. State which of…
- Page 1: Second Letter C 1 2 UUU U UUC UUA Phe UCU UCC UCA UCG UAU UAC UAA UAG UGU Cys U UGC Stop UGA Stop UGG Tyr -- Ser Leu Stop A Trp G UUG CUU C CUC CCU Leu cc CAU His CGU Pro CAC CGC Arg CUA CUG CCA CCG 1st СА Gln CGA CAG CG 3rd letter AUU A AUC AUA AUG ACU ACC ACA AGU Ser AGC u letter AAU AAC AAA AAG Asn He Thr AGA AGG A Arg G Lys Met ACG GUU G GUC GUA GUG GCU GCC GAU Asp GGU GGC U Val GAC GAA GAG Ala Gly GCA GGA GGG Glu GCG 1. Convert the sequence from DNA to Amino Acids. 3-TCACCACTCTGGTCTGGTCATATCTGCCTGATATGAGTACAT - 5' a. direct transcript? b. transcript for translation? c. direction of a? (3' to 5' or 5' to 3') d. direction of a (3' to 5' or 5' to 3') e. translated peptides?You are an extraterrestrial geneticist working at Area 51 to sequence the genome of a recently- captured alien specimen. Following sequencing, you discover a special gene ESF that, when transcribed, produces the mRNA sequence: 5' - AUGCCAGUCUAA 3'. Unfortunately, another specimen in the facility has caused a power outage due to its ability to feed on energy, so you need to determine the amino acid sequence produced from that mRNA by hand. Which of the following options below illustrates the correct amino acid sequence that would be produced as a result of translating the mRNA that you identified? Please note that you will need to use the codon chart to answer this question.C UUU UUC Phe UUA UCU) UCC UCA UAU UAC Tyr UGU UGC Cys Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG FLeu UCG CUU CUC CCU] СС CAU1 CAC САC His САА Gln CGU CGC Arg Leu Pro CUA CUG ССА CGA CUG J CCGJ Which of the following tRNA anticodons could theoretically base pair effectively with the codons 5'-AAU-3' and 5'-AAC-3' through third-base CAG, CGG AGU AAUASN AGC AUU AUC File A AUA ACU АСС АСА AAC FAsn AAA Ser C Thr AGA Arg A AUG Met ACG AAG Lys AGG GCU] GCC GCA GCG GGU GGC Gly GGA GAU1 GUU GUC GUA GUG Asp GACJ GAA C Val Ala A GAG Glu GGG wobble? 5'-GGG-3' OI. 5'-AUG-3' II. 5'-GUU-3' I. 5'-CAT-3' IV. 5'-AAA-3 V. Third letter UCAG UUAG A, First letter
- It is not all of the above (I already tried that).U G Tyr Cys U Tyr Cys C Phe Ser Phe U Ser Leu Ser STOP STOP A Leu Ser STOP Trp Leu Leu Leu Leu Pro Pro Pro Pro Arg His His Arg Gln Arg Gln Arg Ser Ser lle Thr Asn U lle Thr Asn C lle Thr Lys Arg A Arg G Gly U Gly C Gly Gly Met Thr Lys Val Ala Ala Ala Ala Asp Val G Val Asp Glu Glu Val Which amino acid sequence is coded for by the mRNA segment AUG-CCC-CAC-GAA-UAC? O Met-Pro-Gin-Asp-STOP • Asp-Pro-His-Glu-STOP • STOP-Pro-Thr-Lys-Thr O Met-Pro-His-Glu-Tyr p. 1of 31 1st base codon 3rd base in codonCHOICES: Isoniazid Rifampicin Ethambutol None of the Choices Causes more adverse effects to slow acetylators Causes optic neuritis Causes orange secretions Inhibits transcription process in mycobacteria Binds to bacterial DNA gyrase & topoisomerase