When DNA sequence from a diploid individaul is of a 1,0000 nucleotide region. FInd the # of pairwaise differences you can expect between the 2 of these alleles.

Q: In onions, male sterility is due to the interaction of a chromosomal allele pair hh and "sterile"…

A: Cytoplasmic inheritance occurs when the DNA from the parents' cytoplasmic organelles is inherited by…

Q: Mitotic recombination can occasionally produce a twin spot.Let’s suppose an animal species is…

A: It is given to suppose that if an animal species is heterozygous for the 2 gene governing fur colour…

Q: Based on this figure, what is the predicted number of melanosomes per field of view for a…

A: The graph illustrates melanosome counts per field of view for Black and Brown phenotypes, showcasing…

Q: CIOSS OU An organism has the genotype a g*/a"g*; qf"/q*f*;rth*+/r*h+. Indicate the correct genes/…

A: Alleles Allele are alternative form of a gene. For example hight is a one gene but is has two type…

Q: Hemophilia and color blindness are both recessive conditions caused by genes on the X chromosome. To…

A: Recombination frequency is defined as the proportion of recombinant offspring produced in a genetic…

Q: Describe two differences among these chromosomes.

A: Chromosome mapping is the arrangement of the chromosomes. Genetic mapping provides a clue about the…

Q: 8. Which is the correct description of the human chromosome number? * O2n =23 (where n=23, the…

A: Chromosomes are long, thread-like structures made of DNA and protein molecules that carry genetic…

Q: After mating a sinistral female with a dextral male all of the F1 progeny had dextrally colled…

A: Genotype :  Genotype is  refer to a gene or set of genes that leads to a single trait .

Q: For an organism with haploid number of 15, fill in the following table:

A: Haploid cells Haploid cells have only one set of chromosomes. Most of organism produce haploid…

Q: Consider the arrangement of the following four normal chromosomes from some hypothetical organism…

A:

Q: ou want to map three linked genes in tomato: oblate (o) vs. round (O) fruit; peach (p) vs. smooth…

A: Introduction Gene are the basic unit of heredity. A gene exists in 2 alternative forms called…

Q: A. Examine the crosses above and deduce the origin of G. hirsutum. Diagram your cross and give level…

A: The genes are the hereditary unit of an organism. The genes are formed of the nucleotide sequences…

Q: Why should the relative distance between two loci influencethe amount of recombination and crossing…

A: Chromosomal hybrid, or crossover, is the exchange of genetic material during sexual multiplication…

Q: . Human geneticists interested in the effects of abnormalities in chromosome number often…

A: The abnormal number chromosomes in the cell is called as aneuploidy. For example, instead of 46…

Q: What type of chromosomal rearrangement is likely explained the evolution of human chromosome 2 from…

A: Chromosomes  The long thread like structure chromatin condensed to form thick short structure in…

Q: In each of these diagrams (A-D) homologs are shown as the same size and color. A ANE 1 C B Which of…

A: DNA is our generic career molecule. They are found in nucleus of eukaryotic cell. During propage…

Q: What is the process called when all living organism receive physical features and internal features…

A: Heredity- The process by which the features of an organism are passed on from one generation to…

Q: What is the main function of the DNA? * O It can be mutated. It stores information for protein…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: 13.2 13.1- 12. 11 11- 12 22 23 24 HIDGE b с d f g bo h

A:

Q: Figure 1. Showing a homologous pair of chromosomes that carry two linked genes. Here we can see that…

A: Alleles are two forms of the gene. If two genes are linked, their independent assortment during…

Q: 12. The following are the gene order on the chromosomes of an individual who is heterozygous for…

A: As the individual is heterozygous for a reciprocal translocation, the synapsis configuration during…

Q: AA BB CODD -log10(p) Now imagine that you've done a GWAS with those 10 SNPs, plus 7000 SNPs which…

A: Manhattan plot is a type of plot that mainly used to display data with a large number of data…

Q: Can you show the cross? Any explanation would be good

A: Test cross A cross to determine the genotype of an organism with a dominant phenotype. The cross…

Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…

A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…

Q: Trihybrid Cross: Several testcrosses have revealed the rate of recombination for the following genes…

A:

Q: You are given a Drosophila female that looks wild-type but is heterozygous for mutations in tan body…

A: Three-point cross: In genetics, the three-point cross is used to determine the distance between two…

Q: The giant panda has a diploid number of 42, which includes a pair of sex chromosomes that is…

A: A sex-determination system is a biological system that determines the development of sexual…

Q: In the diagram below A and B represent XX Ж A a b b в в Recombinants A A a a b b Select an answer…

A: Introduction The exchange of genetic material between two homologous chromosomes' non-sister…

Q: In an electrophoretic gel across which is applied a powerful electrical alternating pulsed field,…

A: Introduction Gel electrophoresis is a technique that uses size and charge to separate and analyse…

Q: Two genes are on separate chromosomes (i.e., unlinked). One homologous pair of chromosomes carries…

A: case I

Q: If you assume Figure 2-15 also applies to mice and youirradiate male sperm with X rays (known to…

A: The similar regions in two chromosomes  are considered to be homologous. Hence the X and Y…

Q: Two diploid (2N) species of wheat are crossed T. aestivuma (N=20) and T. militinae (N=43), producing…

A: The N represents haploid genotype. There are half set of chromosomes in each cell. 2N represents…

Q: 5. 2/9 (a) Complete the following diagram to show the process by which gametes are formed. 1087 88 B…

A: According to the guidelines of Bartleby,"Since you have posted multiple questions, we will provide…

Q: why Recombination Frequencies BetweenTwo Genes Never Exceed 50%

A: Recombination frequency is determined by the frequency of the recombination eventsbetween the two…

Q: None

A: AnalysisNotation Interpretation:"42A" refers to the normal autosomal chromosomes (humans typically…

Q: Find the correct order of the genes on the chromosome

A: In the given test cross progeny data table, first two highest frequency classes are the parental…

Q: Sex: Chromosomal anomaly: Syndrome:

A: Metaphase chromosomes are chromosomes that are condensed and visible during the metaphase stage of…

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.