What would be the base sequence of the DNA strandacross from ATTGACTCG? If a DNA molecule was knownto be 20% adenine, predict its percentage of cytosineand explain your answer.

Q: Calculate the mass in grams of a double helical DNA molecule stretching from the earth to the moon…

A: We need to determine the mass of base pairs needed to go from Earth to the Moon based on the…

Q: The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' .…

A: DNA, short for deoxyribonucleic acid, is a nucleic acid molecule made up of a sugar called…

Q: Let’s suppose you have recently identified an organism that wasscraped from an asteroid that hit the…

A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…

Q: Select the phrases that accurately describe properties of the most common form of the DNA double…

A: B-DNA is the most stable and predominant form of DNA under physiological conditions. The structure…

Q: If I'm any organism a dna molecule is 24% cytosine, how much adenine will that dna molocule contia

A: The rules of Chargaff are significant because they refer to a kind of "biological grammar," or a…

Q: If the nitrogen-based molecules present in the DNA of an animal are found to be 22.7% thymine…

A: DNA  DNA is a long tread like structure present in the nucleus of an eukaryotic cells. DNA is…

Q: Assume the energy of hydrogen bonds per base pair to be 5.86 kJ-mol-1. Given two complementary…

A: Given Energy of H-Bond per base pair = 5.86 kJ mol-1 Number of Base pair in complementary DNA = 145…

Q: If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA…

A: DNA is a double stranded helical structure found generally in Eukaryotes and prokaryotes while in…

Q: Which strand(s) in the DNA Replication Fork depicted below represent the parent strands?

A: DNA replication is the process by which a double stranded DNA (dsDNA) makes a copy of itself to…

Q: If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became…

A: A point mutation or substitution is a form of genetic mutation where a 1 single nucleotide base is…

Q: Within a protein, certain amino acids are positively charged (e.g.,lysine and arginine), some are…

A: DNA or the deoxyribonucleic is the defined genetic material and it is made up of a base, deoxyribose…

Q: How many of each base is found in the complete double-stranded molecule?

A: The concept is based on Chargaff's rule. It is given by Erwin Chargaff to calculate the amount of A,…

Q: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: Although human DNA has a total length of 2 m, it is packaged into a nucleus that is 5 µm in…

A: Cells wrap their DNA strands around scaffolding proteins to form chromatin, a coiled compact…

Q: The complementary strands of DNA in the double helixare held together by hydrogen bonds: G ≡ C or A…

A: DNA double helix is formed by the hydrogen bonds formed between the base pairs. Adenines forms two…

Q: What is the nucleotide sequence of the complementary strand of this molecule AT GCGA? O CATAG O A AT…

A: Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are well known and well defined as the two…

Q: If the DNA of one human cell is stretched out, it would be almost 6 feet long and contain over three…

A: DNA  DNA is the hereditary unit of an organism which transfer from parents to their offsprings. It…

Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…

A: The central dogma of molecular biology is the metabolic process in which the double-helical…

Q: An RNA molecule has the following percentages of bases: A = 27%, U = 38%, C=20%, G= 15%. (A) Is this…

A: DNA is composed of nucleotide. In nuclear tide there is one ribose sugar, one phosphate  molecule…

Q: consider dna nucleotide sequence CCATGGAATCGA What structure of dna does the sequence represent?

A: Sequencing DNA means determining the order of the four chemical building blocks - called "bases" -…

Q: Analyze two DNA structures Figure 1(a) and (b) below and draw conclusions about their helical…

A:

Q: What part(s) of a nucleotide (namely, phosphate, sugar, and/or base) is/are found in the major and…

A: DNA is a molecule that is in charge of bearing and transmitting inherited information or genetic…

Q: Given the following coding sequence for DNA, provide the sequence of the complementary(template)…

A: A nucleotide is a biomolecule that consists of a nitrogenous base (either a purine or a pyrimidine),…

Q: What is the complementary sequence of the following DNA strand: AATCGTCTAAGGCC

A: The objective of this question is to find the complementary sequence of a given DNA strand. In DNA,…

Q: 1 bp of DNA is approximately 0.34 nm in length. Abacterial chromosome is about 4 million bp in…

A: Bacteria are microorganism that most commonly occur in the soil, air, water and in adverse…

Q: The ratio of (A+T) to (G+C) in a particular DNA is 1.0.  Is this sufficient data to determine…

A: Deoxyribonucleic acid (DNA) is the molecule. that contains the complete genetic code of an organism

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: The chromosome of the bacterium (prokaryote) Escherichia coli has a size of approximately 4,000…

A: DNA stands for deoxyribonucleic acid. It carries genetic information useful for development and…

Q: Examine the 5 -3' sequence of bases of the DNA molecules (A D) shown below. I am only showing you…

A: For option A, AAAT the complementary strand is TTTA. In this A pairs with T by two hydrogen bonds…

Q: otal nucleic acids are extracted from a growing culture of yeast cells. They are then mixed with…

A: Although ssDNA could be a critical intermediary in practically all biological activities involving…

Q: If the sequence of bases on the one of the strand of a DNA molecule 5’ATTGCGGA - 3’ What is the…

A: DNA is a double helical structure composed of nucleotides.The two helices are joined together by…

Q: If you analyze a double-stranded DNA molecule and find that 15% of all the nucleotide bases are…

A: According to Chargaff's rule, [A]+[G]=[C]+[T] where A - adenine G - Guanine C- Cytosine T- Thymine

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: The sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence…

A: Introduction  DNA denaturation, sometimes called DNA denaturing, is the conversion of…

Q: A double-stranded molecule of B DNA contains 340 nucleotidesWhat topic in genetics does this…

A: Nucleic acid is serving as primary information carrying molecule in cells. There are two types of…

Q: Calculate the electric fields and net force between a thymine and an adenine pair. = Calculate the…

A:

Q: Which strand below would be the complementary strand for the sequence AAACGCTT O GGGTATCC O AAGCGTTT…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: here is a chemically synthesized DNA oligonucleotide is 5’–AUCG–3’. Please draw the all-atom…

A: DNA contains nitrogenous bases A, T, G and C while RNA contains A, U, G and C.  RNA is synthesised…

Q: In a single strand of DNA, is it ever possible for the number of adenines to be greater than the…

A: In a DNA molecule purine always pairs with a pyrimidine base. Adenine is a purine base and thymine…

Q: If the nucleotide at position 23 in thw first strand of DNA ia changed to "A", what effect would…

A: The change in the nucleotide sequence can occur due to the mutation in the gene expression. These…

Q: Using the figure below, which end of the double helix,"A" or "B", would be considered the 5 prime…

A: Introduction  DNA is an organic molecule that includes genetic information as well as instructions…

Q: Forming nucleosomes and wrapping them into a 30-nm fiber provide part of the compaction of DNA in…

A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is the…