What would be the base sequence of the DNA strandacross from ATTGACTCG? If a DNA molecule was knownto be 20% adenine, predict its percentage of cytosineand explain your answer.

Q: Calculate the mass in grams of a double helical DNA molecule stretching from the earth to the moon…

A: We need to determine the mass of base pairs needed to go from Earth to the Moon based on the…

Q: Let’s suppose you have recently identified an organism that wasscraped from an asteroid that hit the…

A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…

Q: continuous sequence Explain the statement. of - base

A: The sequence of bases in a portion of a DNA molecule , is called gene . It carries the instructions…

Q: If the nitrogen-based molecules present in the DNA of an animal are found to be 22.7% thymine…

A: DNA  DNA is a long tread like structure present in the nucleus of an eukaryotic cells. DNA is…

Q: If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA…

A: DNA is a double stranded helical structure found generally in Eukaryotes and prokaryotes while in…

Q: Describe the double-stranded structure of DNA, and explainhow the AT/GC rule underlies the ability…

A: the double-stranded structure of DNA is genetic material

Q: As we have focused on DNA, the molecule that stores genetic information in all living things. In…

A: The structure of DNA as double helix was described first by Watson and Crick by using the data of…

Q: What is meant by the statement “DNA strands areantiparallel”?

A: DNA is composed of two polynucleotide chains that coil and form a double helix. It consists of…

Q: How many of each base is found in the complete double-stranded molecule?

A: The concept is based on Chargaff's rule. It is given by Erwin Chargaff to calculate the amount of A,…

Q: Describe the structure of DNA.   The two strands of DNA are antiparallel. What does the term…

A: Describe the structure of DNA. DNA is created from molecules known as nucleotides. every nucleotide…

Q: Provide a chemical explanation of why DNA synthesis proceeds in a 5'- to-3' direction.

A: The genes are the hereditary unit of an organism which are passed on from the parental generation to…

Q: The hydrophobic effect explains why: O Water regulates pH in the interstitial fluid between…

A: The propensity of nonpolar compounds to collect in an aqueous solution and keep out water molecules…

Q: One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic…

A: DNA is the genetic material in living organisms. It carries instructions for making structural and…

Q: Illustrate the major features of DNA’s primary and secondary structure. Explain the concept of…

A: The primary structure of DNA refers to the linear sequence of nucleotides that make up the DNA…

Q: Given the sequences below select all that may have trouble becoming alpha helices. (Select all that…

A: It is the amino acid sequence of a peptide chain that determine which secondary structure the…

Q: If your analysis identifies that the total Cytosine content in a sample is 29%, what will be the…

A: According to Chargaff's rule number of purine(adenine+guanine) = number of pyrimidine (cytosine +…

Q: Analyze two DNA structures Figure 1(a) and (b) below and draw conclusions about their helical…

A:

Q: Which conformation of DNA – (i) totally double helix, (ii) minimally unwound or (iii) largely…

A: Just as a high temperature can denature protein, nucleic acids such as DNA and RNA can too be…

Q: Using the Figure below identify: What is the significance of hydrogen bonds in double helix of DN…

A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…

Q: If DNA concentration is 2 grams, what would be the molar concentration of human DNA in a human cell?

A: Introduction: DNA, or deoxyribonucleic acid, is the genetic substance found in humans and virtually…

Q: 1 bp of DNA is approximately 0.34 nm in length. Abacterial chromosome is about 4 million bp in…

A: Bacteria are microorganism that most commonly occur in the soil, air, water and in adverse…

Q: What can be said about the role of the DnaA protein in bacterial DNA replication? Select all the…

A: DNA replication in bacteria, such as E. coli, is a complex process orchestrated by numerous proteins…

Q: If a double stranded DNA HAS 20 PERCENT OF CYTOSINE, calculate the percent of adenine of adenine in…

A: According to Chargaff's rule, A = T and G = C, as adenine (A) binds with thymine (T) and guanine (G)…

Q: Explain how the functions of DNA emerge from the structure of its monomers and its antiparallel,…

A: DNA is a long deoxyribonucleotide polymer. The amount of nucleotides (or base pair of nucleotides)…

Q: otal nucleic acids are extracted from a growing culture of yeast cells. They are then mixed with…

A: Although ssDNA could be a critical intermediary in practically all biological activities involving…

Q: If the sequence of bases on the one of the strand of a DNA molecule 5’ATTGCGGA - 3’ What is the…

A: DNA is a double helical structure composed of nucleotides.The two helices are joined together by…

Q: Describe the structure of DNA. The two strands of DNA are antiparallel. What does the term…

A: DNA contains all organism's order for growth, survival, and reproduction. DNA sequences must be…

Q: What are the building blocks of a nucleotide? With regard to the 5′and 3′ positions on a sugar…

A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…

Q: What type of DNA structure is recognized by RecG and RuvABC?Do you think these proteins recognize…

A: Deoxyribonucleic acid (DNA) is a genetic material of most organisms. DNA contains the instructions…

Q: A double-stranded molecule of B DNA contains 340 nucleotidesWhat topic in genetics does this…

A: Nucleic acid is serving as primary information carrying molecule in cells. There are two types of…

Q: Calculate the electric fields and net force between a thymine and an adenine pair. = Calculate the…

A:

Q: 1. In a sample solution given for analysis; CATAGCTTTGTTAAA (DNA nucleotide chain). a) Show the 5…

A: Genes contain the instructions a cell needs to make proteins. Making proteins from DNA requires a…

Q: Basic features of the central dogma of molecular genetics is

A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…

Q: Tabulate the differences of the various DNA conformations in terms of orientation, rise per base…

A: The DNA duples model proposed by Watson and Crick was right handed spiral known as B-DNA. apart from…

Q: To which end (5′ or 3′) of a newly synthesized strand of DNAdoes DNA polymerase add a nucleotide?

A: DNA (Deoxyribonucleic acid) replication is the coping of the double-stranded DNA to produce 2…

Q: In the early 1950s, it became clear to many researchers that DNAwas the cellular molecule that…

A: DNA ( deoxyribonucleic acid) is the genetic material that the organism inherits from the parental…

Q: If one side of the helix is CACTGGACTGTG, the complementary side would be??

A: There are two types of nucleic acids present in our body, DNA and RNA. DNA is the genetic material…