Answered: What is the output of this C code?…

What is the output of this C code? #include int main() { float f = 0.1; if (f == 0.1) printf("True"); else printf("False"); } a) True b) False

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Q: PYTHON HOMEWORK QUESTION def area(side1, side2): return side1 * side2 s1 = 12 s2 = 6 Select…

A: Here, a function area is defined which is accepting 2 arguments and then returning the area by…

Q: C++ Visual 2019 A particular talent competition has five judges, each of whom awards a score…

A: Note: As score can double data type ,so, return type of findLowest() and findHighest() function…

Q: include int main() { int M; printf("Enter the number of chairs you want to…

A: As your question , i run the code i got two issue in the given code:…

Q: main (void) void qst (float a, float b, int "y) float a = 3.0, b = 2.0; int y -6; %3D int x - 4, w-…

A: C program used to answer this question

Q: The following C program calculate the volume of a cylinder. 1. #include 2. int main(void) 3. { 4.…

A: In this program only lines 5 and 6 is changed #include <stdio.h>void volume_cylinder(double…

Q: Find the error(s) in the following code segments and fix them: if ( temperature = 100 ) cout <<…

A: Solution :

Q: QUESTION 23 Given int *ptr, x[6]={11, 238, 4, -70, 9, -53); What the following statement does?…

A: The given code: *(x+3)=12

Q: #include using namespace std; int main() 3 { int x,y; or (x=0; x 3) break; cout << y << endl; }}}

A: The given code consists of two nested for loops.

Q: 8.) #include int main() { } int a; char *x; x = (char*) &a; a = 512; x[0] = 1; x[1] =2;…

A: Given: Why does this C program produce a large endian output of 258 but a little endian output of…

Q: #include #include int LineFunc(void); int main() { int a, b; printf("Enter a :"); scanf("%d", &a);…

A: In code draws a line which is in the form of y = mx+c The input to the code is a and b where a = m…

Q: #include #include void main(void) (int number; Cout > number; if ( number > 100) cout <<" number…

A: The above program is for checking if number>100 then a message is displayed "number is greater…

Q: 19-6) Recursive Power Function Write a function that uses recursion to raise a number to a power.…

A: The following program is implemented in c++ 1.#include <iostream> 2.using namespace std; 3.…

Q: #include <stdio.h>int main(){int d;int s[20],i, r, p, lg=0,m;char c;printf("Enter number of…

A: Add the statement “i+1” in the print statement: printf("salesman %d ",i+1); Add another array to…

Q: Void Do1 (int: &, a. int &b) { a = 5; a = a + b; b = a + 2; } Int main() {…

A: We have given a C++ code and in which pass variable by reference. Here, integer variable x pass by…

Q: Every line of this c program please explain. Thank you Source Code: // include necessary…

A: //include hearder files for using C++ supported library//include cin, cout, etc libraries#include…

Q: 2) class selection_statements { public static void main(String args[]) int var1 = 5; int %3D var2 =…

A: The output of the above-given program is 2. Therefore, the correct option is an option (b).

Q: HUK computer store offers credit plan at 10% down payment and an annual interest rate of 12%. You…

A: The given is the programming problem that needs to be solved using C++. The user will be asked to…

Q: PROBLEM: Write a program which accepts a number corresponding to a plane figure: 1. Right Triangle…

A: C++ program to find the area ,perimeter and circumference of Triangle ,Rectangle and Circle

Q: Please remove some minor errors from the program.

A: The correct code is shown below. Sample Response: #include<iostream>#include<cmath>using…

Q: C++Write a program to define a function that is used to return the volume and surface area of a cube…

A: C++ is one of the most popular programming languages developed by Stroustrup at Bell Labs. The basic…

Q: Add screenshots of outputs as well Execute the following example and write a comment after each…

A: The code after adding the comments is as follows: #include<iostream> #include<string>…

Q: Integer variables totalBudget and productCost are read from input. A product costs productCost to…

A: SOLUTION-I have solved this problem in C++ code with comments and screenshot for easy understanding…

Q: using namespace std; int main () { int x = 3; if (!x) if (x = 4) cout << "AAA"; else cout << "BBB";…

A: Code is given:

Q: Case Study – Decimal to Other Base System Design and develop a solution with functions (modules),…

A: Find the required code in C++ given as below and output :

Q: When I was a kid, I used to watch this TV game show, Deal or No Deal? in the game, there are…

A: Iterate over the array from beginning to ending and compare each and every element with the input…

Q: i need solution very very quickly please #data structure in c++# #the question below# The cafeteria…

A: for (int i = 0; i < k; i++) { //taking id as i+1 i.e. start from 1 intavg; avg = rand() % 100;…

Q: C-code blocks The program displays the numbers 50, 45, 40, … 10, 5, 0 using a while loop. Write…

A: The Answer is

Q: Find the error(s), if any 1) void main() { int a = 15; float b = 10; char cha = 'a'; char chb =…

A: 1.) Following errors are present in the given code: //statement with error void main() Error: As the…

Q: ode not Java

A: Since in give code segment, there is used a special type of variable called static which works on…

Q: Assume a, b, c and n are float variables, and d, e, fand m are integer variables, what is the result…

A: As I have read the guidelines I can provide answers to only 1 part of the questions in case of…

Q: Computer Science please use c++ to solve these data structures problems with Memory limit: 256…

Question

What is the output of this C code?

#include <stdio.h>

int main()

{

float f = 0.1;

if (f == 0.1)

printf("True");

else

printf("False");

}

a) True

b) False

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

THIS IS FOR C++ ONLY Part 2b: Password Verification A secure password is critically important in today's world. Organizations typically have stringent requirements to ensure a password is complex enough so as not to be easily hacked. Write a program that will accept as input a potential password and determine whether or not it is valid in meeting the following criteria: at least eight characters long at least one uppercase letter at least one lowercase letter at least one digit at least one special character (you can determine what is acceptable) If the password is valid, ask the user to enter it again. If it matches, indicate the password has been accepted. If the password does not meet any of the above criteria, indicate which it does not meet.
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
C++ Nothing too advanced please. Learning the basics #include <iostream>using namespace std;int main()
Fundamentals of Programming in C Language Write the value of each of the following expressions, using the following data declarations: double m = 17.5; int y = 9; 1. (m > 12.0) && (y / 2 <= 4) 2. (y % 3 != 0) 3. (m < 2 * y) 4. (2 == 3) || (m - 16 >= 0)
// Computation.cpp - This program calculates sum, difference, and product of two values.// Input: Interactive// Output: Sum, difference, and product of two values. #include <iostream>#include <string>void calculateSum(double, double);void calculateDifference(double, double);void calculateProduct(double, double);using namespace std;int main() { double value1; double value2; cout << "Enter first numeric value: "; cin >> value1; cout << "Enter second numeric value: "; cin >> value2; // Call calculateSum // Call calculateDifference // Call calculateProduct return 0;} // End of main() function// Write calculateSum function here// Write calculateDifference function here// Write calculateProduct function here
Question 13 In C programming, construct an expression to express the following test condition: Tests that str1 is not equal to "xyz" and the length of str1 is less than or equal to 3
C++ Plz solve as you can quickly
Programming Language: C++ 4. Select the two correct statements about stub functions: Select one or more: a. stubs are used to test the functionality of a program b. stubs must return a value c. stubs are programs that test if a called function returns the correct result d. stubs are simpler than the functions they replace
Answer complete 6th question please
Needs to be done in C# language. Problem Write a program that computes and displays the charges for a patient’s hospital stay. First, the program should ask if the patient was admitted as an in-patient or an out-patient. If the patient was an in-patient, the following data should be entered: • The number of days spent in the hospital• The daily rate• Hospital medication charges• Charges for hospital services (lab tests, etc.) The program should ask for the following data if the patient was an out-patient: • Charges for hospital services (lab tests, etc.)• Hospital medication charges The program should use two overloaded functions to calculate the total charges. One of the functions should accept arguments for the in-patient data, while the other function accepts arguments for out-patient information. Both functions should return the total charges. Input Validation: Do not accept negative numbers for any data.