Answered: What is printed to the terminal when…

What is printed to the terminal when the following code snippet runs? int count = 0; for (int a = 0; a < 2; a++) { for (int b = a; b < 5; b+) { %3D count++; } } println(count); 3.

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

What does the function f do? struct Point2D { double x; double y; struct Triangle { Point2D v1; Point2D v2; Point2D v3; }; void f(Triangle&t) { } int temp = 12.5; temp = t.v1.x; t.v1.x = t.v1.y; t.v1.y = temp; } int main () { Triangle mytri; mytri.v1.x = 1.0; mytri.v1.y = 22.5; f (mytri); Swaps values of x and y in vertex 1 of an argument of type Triangle Initializes value of x in vertex 1 of an argument of type Triangle Sets all x,y values in all vertices of an argument of type Triangle Swaps value of x in vertex 1 with value of x in vertex 2, for an argument of type
Determine all the output from the following program as it would appear on the screen. void func1(int); void func2(int = 4, int = 5, int = 2); int func3(int &, int, int); %3D int main() { int x = 0, z = 0, y = 2; func1(y); cout << y << endl; func2(x, y, z); func2(); func3(x, y, z); = Z func1(x); cout << x << " " << y << " " << z << endl; return 0; } void func1(int b) { static int a;
Please explain this question void main() {int a =300; char *ptr = (char*) &a ; ptr ++; *ptr =2; printf("%d", a); }
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
Which aggregating operations are allowed for struct variables but not array variables, and which are not?
C++ code. Please describe what EACH line means/does. Ignore code that is commented out.