What are the reagents found in a restriction enzyme digestion buffer? What are the roles of these reagents?

Q: 13. Fill in the blanks using the keywords. +2 NADH +NAD+2 2 coenzyme A MITOCHONDRIA + CO₂ Glycolysis…

A: Introduction Glycolysis is a first step of cellular respiration. Glycolysis consists of 10 steps. In…

Q: 5. Consider two proteins with a pl. of 4.5 and pl. of 7.7? Using a cation-exchange column, describe…

A: Ion exchange chromatography (IEC) is a commonly used separation technique in biochemistry and…

Q: Can someone please show your work for tracking the radiolabel: draw structures indicating position…

A: The given structure is a polysaccharide - starch (amylose) with alpha 1,4 glycosidic bond. It…

Q: cysteine amino acids together in the formation of a disulfide bond and the biological compound…

A: TLC is a versatile and widely used technique in chemistry and biochemistry for separating and…

Q: 9. Briefly describe and draw the structure of the following disaccharides in their ring structure.…

A: A. Sucrose structure: O O| || || |O-C-O-C-H H-C-O-C-O| || || |H H B. Maltose structure: O O| || ||…

Q: From the following information determine the amino acid sequence of a peptide. N-terminal Edman…

A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…

Q: Tyrosine is considered to be non-essential in the diet. Please explain what that means and what…

A: Proteins are made up of molecules called amino acids. Proteins and amino acids are the components of…

Q: 3. A. Briefly discuss the four levels of structure in proteins. Knowing that the 3-dimensional shape…

A: Protein is a polypeptide made up of amino acids. The sequence of amino acids determines the…

Q: 1.c)B vitamins are involved in energy production. must be injected to be effective. are fat-soluble.…

A: B vitamins are water soluble vitamins which are of classified into 8 types. they are  Thymine ,…

Q: If you wanted to estimate the molecular weight of a newly isolated protein (no known amino acid…

A: If you want to estimate the molecular weight of a newly isolated protein with no known amino acid…

Q: Genetic disorders of urea synthesis

A: As a result of our metabolism, amino-acid metabolism specifically, a lot of ammonia is produced in…

Q: Question 5 What would occur if the concentrations of GAP and GEF were reversed? (high [GEF] in…

A: Answer; imported cargo proteins would not be released in the nucleoplasm Explanation: If the…

Q: RC B H₂N-C- C A B H This content is protected and may not be shared, uploaded, or distributed. C A D…

A: Amino acids are the building blocks of protein. Structurally they contain compounds such as carbon,…

Q: Isolate B Isolate A Isolate C Isolate D The purity and concentration of DNA isolate can be evaluated…

A: DNA purification is a process used to isolate DNA from other cellular components. The most common…

Q: This SDS-PAGE loading buffer has SDS (a denaturing detergent), β-mercaptoethanol (a reducing agent),…

A: DF can be expressed as ratio of concentrations and as ratio of volumes. DF=Final volume after…

Q: 1.a) Which one of the following would be a component of innate immunity? antigen SARS-CoV-2…

A: Innate immunity can be defined as the general non specific immune response that is developed by…

Q: When the disaccharide is hydrolyzed, the monosaccharide units that are produced are

A: Carbohydrates are one of the three macronutrients that provide energy to the body, the other two…

Q: Two common methods of denaturing proteins in the lab are to increase the temperature and/or add…

A: Proteins are biomolecules with diverse biological roles. The function of a protein depends on its…

Q: A carboxypeptidase is a metalloenyme (its active site contains one or more metal ions essential for…

A: An active site of an enzyme is a three dimensional structure that occurs within the enzyme. An…

Q: Mevalonic acid high or low in vegetarian diet?

A: Mevalonic acid is a key intermediate compound in the biosynthesis of isoprenoids, a large class of…

Q: The radiolabel shown on the image in glycogen is used for conversion to ribose 5-phosphate while…

A: Glycogen is a polysaccharide and the storage form of carbohydrates in animals. It is a homopolymer…

Q: Draw estimated macroscopic currants for Na and k by multiplying the single channel

A: The sodium-potassium pump is also known as the Na+/K+ ATPase pump. It is a type of active transport…

Q: In kilodaltons (KDa), what is the predicted molecular mass of the protein encoded by this gene…

A: Molecular weight of the protein can be calculated by adding the molecular weight of the individual…

Q: 67. What is the CORRECT terminology for reactions A and B in the diagram? ( (ADP) o- (ATP) 70. Water…

A: There are several types of chemical reactions, including: hydrolysis, condensation, redox,…

Q: T F T F T F T T F F T F T F Vmax is the velocity observed when all of the enzyme present is fully…

A: The kinetics of an enzyme-catalyzed reaction can be described using a variety of parameters,…

Q: 1. 2. 3. Why does casein precipitates upon the addition of acetic acid? Why is milk used as an…

A: Casein is a phosphoprotein found in milk and so also called as milk protein. It has an isoelectric…

Q: which of these describes the symptoms of the disease(s) caused by mutations in this gene…

A: Mutation in the following gene i.e. XPA gene, causes malfunctioning of DNA repair mechanisms of our…

Q: What is the concentration of the cough suppressant in parts per million?

A: Some solutes might be present in a solution in very little amount. So, the concentration of these…

Q: Choose in the options what do enzymes do for the activation of energy of the reaction -Ea, given the…

A: Enzymes act as catalysts and catalyse the reactions by increasing the rate of reaction. In collision…

Q: The glycolytic enzyme aldolase catalyzes the following cleavage reaction: Fructose 1,6-bisphosphate…

A: Aldolase is an enzyme that catalyses one of the reaction of glycolytic pathway by performing a…

Q: Different breeds of Korean cattle produce meat with varying amounts of stearic, linoleic and oleic…

A: Fatty acid synthase (FAS) is a large multifunctional enzyme that is responsible for the synthesis of…

Q: The following prokaryotic DNA is transcribed into RNA and the mRNA transcript is translated into…

A: The region of prokaryotic DNA that will be transcribed into mRNA is determined by the presence of a…

Q: What is the structure of the peptide P-A-I-G-E at a pH of 7 and 12? What is the isoelectric point?

A: A peptide is a short chain of amino acids that are linked together by peptide bonds. Peptides are…

Q: Suppose that you wish to measure the concentration levels of PCBs in air inside a school. You are…

A: PCBs (polychlorinated biphenyls) can be found in many places, including industrial sites, landfills,…

Q: Prepare a schematic diagram and present it. The Figure should illustrate the interactions made…

A: Binding of drug to receptor or protein can be specific and non-specific. For the genuity of the…

Q: In the traditional alkaline lysis method of Solution 1, what is the purpose of Glucose

A: Alkaline lysis is a method for extracting DNA from cells, particularly from bacterial cells. This…

Q: Consider the following peptide: alanyl-glutamyl-lysyl-cysteyl-asparagine. 1- Write the…

A: The given peptide is comprised of 5 amino acids. In order to write the name of a peptide , we add…

Q: How do pH levels affect biochemical reactions?

A: pH is a measure of the acidity or alkalinity of a solution. It is defined as the negative logarithm…

Q: 5 For the peptide structure in #3, (ASP-ALA-THR-LYS-GLY), use the chart at the end of this HW set…

A: The proteins are composed of twenty naturally occurring amino acids.  The amino acids can be…

Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…

A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…

Q: A. hand-draw the chemical structures of dipalmitoyl phosphatidyl choline, DPPC (also known as…

A: Lipids are classified into charged and neutral lipids based on the presence of phosphate group.…

Q: 3. Tyrosine kinase receptors are pairs of proteins that span the plasma membrane. On the…

A: Enzymes can exhibit cooperativity, which refers to the phenomenon where the binding of a substrate…

Q: Identify different types of organic reaction mechanism (SN1, SN2, etc) and reaction types (addition,…

A: SN1 reactions are substitution nucleophilic reactions that occur in a single step. They involve the…

Q: How could you improve upon your technique in order to get a better and more accurate standard curve…

A: A standard curve have the Absorbance values at a particular wavelength  (Absorbance at 595nm  i.e.…

Q: 1. A substrate is converted to product using an enzyme that follows the mechanism below when an…

A: Since you have posted a question with multiple sub-parts, we willprovide the solution only to the…

Q: 13. Draw the structure of the amino acid lysine showing the correct protonation states of its acid…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: describe the principal reactant and products of major steps of glucose oxidation

A: Three distinct metabolic pathways are involved in cellular respiration, which is where glucose…

Q: 11. Calculate the equilibrium constant for the hydrolysis of glucose-1-phosphate at 25°C AG for the…

A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the rate of forward…

Q: 1. Consider the peptides P-A-I-G-E and M-A-T-T. a. Draw the structure of each peptide at a pH of 7.0…

A: Formation of the peptide bond neutralises any charge due to the alpha-amino group and alpha-carboxyl…

Q: 4. What is the net charge (approximately) on the polypeptide shown below at pH 12.5? Lys - Arg - Val…

A: Amino acids are the building blocks of proteins. The structure of amino acid consists of a central…

Nutrition and Digestion

The process of consuming nutrients to utilize them for various biological purposes is known as nutrition. The substances absorbed from food are known as nutrients. They serve different important functions in the body, such as repairing wounds and damages, generating energy for metabolism, and regulating biochemical reactions.