Vrite the entire primary structure of the peptide. (Remember you may use the three etter abbreviation or the single letter abbreviation. To get a mark, use the three letter bbreviation in this question item. Use dashes (-) to separate each amino acid and no paces in the answers). Met-?-?-........ (This is the primary structure of proteins; which is in fact, the amino cid sequences in the polypeptide chain.) Write as amino acid 1-amino acid 2- and so on; se the three letter abbreviations and separate them with dashes and no spaces). gain, the DNA segment containing the gene sequence encoding for the peptide is as ollows: (this is a continuous sequence of only 1 DNA strand) GTCCCGGATGCCAAGCGTAGGCCGTTGCGGCATGG CCTAAGA TCGCATCCTGAAACGCC
Proteins
We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.
Protein Expression
The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.
![Write the entire primary structure of the peptide. (Remember you may use the three
letter abbreviation or the single letter abbreviation. To get a mark, use the three letter
abbreviation in this question item. Use dashes (-) to separate each amino acid and no
spaces in the answers).
Met-?-?-........
(This is the primary structure of proteins; which is in fact, the amino
acid sequences in the polypeptide chain.) Write as amino acid 1-amino acid 2- and so on;
use the three letter abbreviations and separate them with dashes and no spaces).
Again, the DNA segment containing the gene sequence encoding for the peptide is as
follows: (this is a continuous sequence of only 1 DNA strand)
GT CCCGGAT GCCAAGCGTAGGCCGTTGC GGCATGGCCTAAGA
TTCGCATCCTGAAACGCC](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F53c8e9f3-70d8-4090-b2af-4da848eb9264%2F2ed5d433-c1a1-4367-b41f-2ef13ebe452f%2Fffoy30r_processed.png&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 3 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Molecular Biology of the Cell (Sixth Edition)](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Laboratory Manual For Human Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Inquiry Into Life (16th Edition)](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)