Vienane adT 11 If 0.1 ml of a 10-3 dilution of a culture is plated out and 65 colonies : CFU/ml were in the undiluted culture? appear after incubation, how many
Q: How many will be present in 15 minutes? * In t minutes there will be At) bacteria present in a…
A: Bacteria are single-cell prokaryotes. They reproduce asexually through cell division. The cells…
Q: What is the use of heat in Seliwanoff’s, Benedict’s and Barfoed’s tests?
A: Carbohydrates are macromolecules comprised of carbon, hydrogen, oxygen. They are also known as…
Q: Q1. If you add 25 g of food in 225 ml water, after mixing well, 1 ml is taken and added to 10 ml of…
A: Introduction :- Incubation is the process of ensuring the development of eggs or, under laboratory…
Q: 17. A flask with a surface area of 25 cm2 can hold 15 mL of new media. O True O False
A: A conical flask is one of the routinely used laboratory equipment for scientific research. In…
Q: 11. You are given a pre-made dilution of 10^-3 and your dilution factor is 10^-7 from which 100…
A: Concentration is the term used to define the amount of a substance present in a solution. It can be…
Q: answer: 0.01 mL concentrate I want to know how it is solved.
A: Prescribed dose is 10 mg/ml Sterile water for injection - 100 ml.
Q: Zinc Floatation 1. What parasite may be recovered out of this procedure? 2. What are the…
A: Zinc floatation is a test that is performed to diagnose the intestinal parasites in the fecal…
Q: 5 tsp po day 1, then 2.5 tsp po days 2-5 How many milliliters should the pharmacy dispense?
A: In the present scenario, the medicine prescribed is 5 tsp per oral for the first day and 2.5 tsp…
Q: what is the purpose of filling an API rapid 20E incubation tray with water
A: The goal of this study was to see how well the API 20E and API Rapid NFT systems worked for…
Q: 13. Suppose that a person who has one hand in a uniform beam of x rays receives a dose of 90…
A: Radiations are used for diagnostic and treatment purpose both. Radiation is used very cautiously.…
Q: 2- Why must not the precipitate in iron determination be ignited at too high a temperature?
A: Precipitate of iron is iron (lll) hydroxide. They formed by in a test tube where iron is present…
Q: 10 If 3 ml of culture is diluted by adding 9 ml of water and the absorbancy reading of the diluted…
A: Sol: Given Volume of the culture used = 3 ml Volume of…
Q: 4. What is the volume of broth that can be picked up by a loopful of a sterile inoculating loop? How…
A: CFU refer to the number of colonies of a microorganism that grow on media. This value represents the…
Q: 26-UDer elution mobile phase stationary phase distribution constant (c) retention time (f) retention…
A: a)Elution : The process of separation of one material from another by a solvent is known as elution.…
Q: Sheet Extraction ODD EVEN ODD EVEN GROUP Single Extraction 1 Single Extraction 2 Multiple…
A: two layer in procedure in which caffeine can be extracted is - first tea is placed in a porous…
Q: Q1/: Compare the contact time necessary to obtain 99.99% kill of bacteria in water under the…
A: Tc = contact time, c=concentration Let No = 100 N = 0.01
Q: Qualitative Analysis of Urine 1. In benedict's and fehling's test, why does the green color product…
A: The chemical test that helps check the reducing sugar reduction in the given analyte is called the…
Q: Smear Preparation 1. What are two goals of a good smear? 2. Why does a bacterial smear need to…
A: Smear preparation: Spreading the culture on the slide and making a smear is the first step in the…
Q: Question 4: Starting with a culture that contains 5.0 x 107 CFU/ml, describe a serial dilution…
A: Given values: Initial culture cell concentration = 5×107 CFU/ml Final colonies on the plate = 50
Q: 1. One mL of sludge was added to a 99 mL dilution blank. Three 1/10 dilutions were then made. From…
A: CFU/ml represents the number of colony-forming units in the sample. It gives us the estimation of…
Q: 31. Serum and vitamin extract càn be sterilized using the. which are of different sizes. monagement…
A: Hello. Since you have posted multiple questions and not specified which question needs to be solved,…
Q: 20. Order: Ibex 20 mg IVPB stat in 50 mL NS infuse in 60 minutes. The Ibex vial reads: add 21.4 mL…
A:
Q: Table 11.6 Absorbance at 470 nm of Peroxlde/Peroxldase Solutions 0.0 min 0.5 min 1.0 min 1.5 min 2.0…
A: Hello, since you have posted a question with multiple sub-parts, we will solve the first three parts…
Q: 9. A flask contains 100ml of bacteria in a broth culture. If the concentration of bacteria in this…
A: Formula : Bacterial concentration = #colonies / (dilution × volume plated in mL)
Q: Which color is obtained when protein is treated with Ninhydrin solution? A. Purple B. White C.…
A: In this question we have to describe about protein detection test.
Q: Inoculate 250-μL overnight cell culture into 50 ml LB medium (in a 250 ml flask). Shake vigorously…
A: Cell culture requires specific media according to need of the cells. The media after inoculation is…
Q: Why is 70% ethanol rather than pure ethanol preferred for use as an antiseptic agent?
A: Disinfection is referred to as cleaning a surface with a chemical compound so as to destroy…
Q: 4. Which food tested in table 2 has positive result for ethanol emulsion test? 5. What kind of foods…
A: Fatty acid is a carboxylic acid with a long hydrocarbon chain. The presence of fat in a food sample…
Q: One hundred microliters (0.100 ml) of a 10-5 dilution of a bacterial suspension plated on an agar…
A: Colonies of bacteria live on solid media. A colony is characterized as a detectable microorganism…
Q: Q9) Given the following sample preparation 200 microliters of BSA (protein) at 240 micrograms/ mL…
A: A spectrophotometer is an analytical device that measures the emission or reflection of visible…
Q: 06. The chromatogram represents the separation of the components of a mixture after development.…
A: Chromatography is a physical method for separation of compounds. It is based on a very simple…
Q: Death kinetics of bacteria in milk treated at 67 °C 1.0E+05 1.0E+04 1.0E+03
A: Decimal reduction time (D) is the time required to destroy 90 % of the microbes in a sample. D is a…
Q: 1. In a serial dilution, one initially sets a starting dilution and adds an aliquot portion of it…
A: Serial Dilution is a important procedure to obtain the desired concentration of reagent or serum or…
Q: 2. Molten agar mixed with bacterial suspension has a temperature higher than 45˚C Effect:…
A: Bacterial culture requires nutrition for growth in any environment be it in vivo or in vitro. Thus,…
Q: Phenol Red Test Question:
A: Phenol Red Broth is a differential test medium typically used to differentiate gram-negative enteric…
Q: Date Sheet Extraction ODD EVEN ODD EVEN GROUP Single Extraction 1 Single Extraction 2…
A: Extraction is a process of separation of components present in plant or animal tissues by means of…
Q: 1. TRUE OR FALSE (explain your answers) a) Enrichment medium should not contain inhibitor to allow…
A: Please follow step 2 for detailed explanation.
Q: 6-Before curing cycle, ideally the properly packed flask should be allowed to stand for: A-5-10…
A: Curing cycle: During the exothermic cross-linking of epoxy resin heat is generated, this curing…
Q: Q24. i) Justify the reason that normalizing heat treatment process is less expensive compared to…
A: i ) Normalizing heat treatment is used to remove impurities from steel. It also increases the…
Q: Time point (min) Absorbance of culture at 660nm Approximate cell concentration Approximate #…
A: The growth curve of a bacterial growth consists of four phases namely lag phase, log or exponential…
Q: Why is potential Hydrogen (pH) important to Biology?
A: The pH of aqueous or other liquid solutions indicates how acidic or basic they are. The phrase,…
Q: 3. You count 116 CFU on a pour plate. The plate was prepared by spreading 0.l mL of a 1:10,000…
A: Answer: CFU : Colony Forming Units is the number of viable bacterial cells per millilitre of a…
Q: New December 18, 2020. The nitrite in a series of standard solutions (mg/L, n = 5) are converted to…
A: Absorbance is the fraction of intensity of light that is absorbed by a material . According to…
Q: Acid Ether Concentration 1. What other sedimentation techniques are available for the recovery of…
A: For complete ova and parasite examination, fecal concentration is one of the routine procedures.…
Q: AE, 62, Male Wt: 75 kg, Ht: 150 cm Orders: Penicillin G Potassium 10,000,000 Units…
A: Penicillin is an antibiotic drug obtained from the fungus Penicillium. It contains a four-membered…
Q: 8. Tube number 1 contains a broth culture of bacteria. You transfer 30ml from tube 1 and place it…
A: Answer: SERIAL DILUTION METHOD : It is method of diluting the bacterial culture from one to other…
Q: 3. For the tests listed in following table, describe the appearance of a positive result. In the…
A: Benedict’s test is performed by heating the reducing sugar solution with Benedict‘s reagent. The…
Q: 3. After performing a viable plate count the following results were recorded. 10-5: 8632 colonies,…
A: A colony-forming unit (CFU) is a unit that is used in microbiology to measure the viable number of…
Q: THIN-LAYER CHROMATOGRAPHY 1. What is the purpose of placing a filter paper inside a beaker or…
A: Hi! Thanks for you question. But there is no image of the chromatogram provided in the question,…
Q: 100 mL Sterile water for injection q.s. Sig: as directed How many milliliters of a 100 mg/mL…
A: Available concentrate of Rhus toxicodendron extract is 100 mg/ml. While required concentrate is 10…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- W V U ing were the items labelled "X" produced ? que #+2 and #3. -X -Y N -ZFile guft 1.yt Machine Cochise14ee7 Lane 0 Pmer. DTarPOPD mob Comment 17703 Spacing 15.06 Siga C 17A 4 G 2 Bases 0 an 2004 Gelstat ime123 219 20 30 60 70 NNACTCA TCTOGTGGA TTC CTA TCCTG AC A AG TGATGTG CAAAC TG GTAACTC TG AG GCAGATAAC CA G GG CA AA AAGGTG TATAAG 100 110 140 100 CAGA AG TC CGGA AA A TCA TT TAA 170 TAAA ACA AAGCCCTAACT TG GAAG AAGT TCA GTTTTACACA TCT TTA TA TG GAGAGAA 180 TAT TCTAT TA ATOTCCTGT TA TATT TG TCA TATTCA TA CAGT TGTCACAGTATATT TCAAAC CA AC TG TTTAAAA ACAAAC TO AAATAAA 210 230 240 260 270 AAATTTAAATACCCT TA TG TA AA ATAG GCT TC CC TG GTG GCTCAG GG GTAAAAA ACTCGC CCGC CA ACGCAG GAGATGTAGAT TTGATC CCT 300 310 340 350 410 430 440 GG GT TAG GA AG icCCTa GAGA AGGAAATGAAAAAC CACTCTAG TAT TCT Tac CTG GG AAATC CCA TGGACAG AG GAGCOTO GAG G Gc 490 500 SI0 530 TACAGTCCATGGGAGTCGCAA A AGAGT TG GACATG ACTAA ACA ACAACATATAAAATAACCT TACTC CATAATGTCAAACT TATOTCACAC S40 AAA ATGCAA AGT TCT TACATCTAT TAACTTTTATGOT TAAATATA ACCTAATGCACTOTTT TATACAGCA ACAACTACT TT TT TATTT TAAA…A client has been ordered methyl Pprednisulune 30omg luPB In 30mL D5W Over 15 min.stat fur an asthma att-acis. in Stous,you have methylpredrisolune 500mg vials . The reconstitutiun Instructions are: Add 7.8mL G Sterile uater and shale genly Each reconstituted uial contains 8mL. a) Houw nmuch medieation will you draw up? 6) what is the Infusion rate in mt/ hr ?
- od 1 Meet- zpn-oxtp-bxu Unit 2 test - cells, organelles, mer X G In order to deteminie how cells rx A testing.illuminateed.com/assessment/5f765e7b4c2b2eb5078b7842/5f765e7b4c2b2eb5078b7843/1?rldbqn=1 ail YouTube Maps O News (1) Facebook Launch Meeting - Z... TikTok sues U.S. go... i! Spanish Present Pro... embrane, transport fall 2020 D. Water moves into and out of the cell at the same rate since the cell is isotonic to its environment. 7. In carrying out normal activities, cells use oxygen and produce carbon dioxide. The concentration of oxygen is higher in the blood than inside the cell, so oxygen moves into the cell. Similarly, carbon dioxide moves out of the cell into the blood because the concentration of carbon dioxide inside the cell is greater than the concentration outside the cell. How do the small molecules of oxygen and carbon dioxide move through the cell membrane?Lab 2 MicrosCO X Copy of Lab 2 X M Inbox (53,887) x b Answered: 4. 1 x C Search Textbo X + /d/1lq1XGTjeDOK-AZLP5NCDYYPZT3K6_fPLnwx-GvHgLnU/edit# Normal text Arial 12 %00 L 1 2 3. 4. 5. 9. Observing Bacteria in Colonies In fresh or saltwater habitats, cyanobacteria will appear (without a microscope) as very small green lines (as can be seen in this video). Observe the following images of cyanobacteria colonies under 100x and 400x magnification with a light microscope: Anabaena sp. 100x magnification Anabaena sp. 400x magnification As you can see, cyanobacteria grow as two different types of cells: those that are photosynthetic (fixing carbon dioxide to make sugars), and heterocysts (that fix nitrogen to make proteins and nucleic acids). Although these cells are genetically identical, each is able to accomplish this via differences in gene expression, a key concept in biology you will continue exploring this quarter. In the 400x magnification image, you should be able to clearly see two…HonorSociety org č. * SpiasiLa * Maps New Tab Describe your color observations of the Nitrate test. a. after adding Reagents A, B (and/or znic): cements b. Did the organism reduce nitrate? (yes or no) ments c. Is the final product nitrate, nitrite or ammonia/nitrogen gas? sions ing es Question 13 4 pts y Resources ules Based on your observations of the SIM test: ple a. Did sulfur reduction occur (yes/no)? zes b. Did the organism produce the enzyme tryptophanase (yes/no)? abus m c. Is the organism positive or negative for the motility test?
- You counted 4, 6, 12, 3 cells in each of the 4.outed squares of a hemacytomeyer. What are the cells per milliliter in that culture? If you resuspended your cell pellet 2.5 mL, what is the total cell count? How many uL do you need to add to a new culture if you want 4250 cells?8:02 PM A docs.google.com © 11% 4 FALSE TRUE Tne pr tatic creti TL. whi -Wh ubilit .ate The ora ved cll re oce лосе ertili on s ur J ir rura .ure Jid Tme fih , car test vi tion d in sexu sal Interr : loca ey int ce s from s* urc and ar th, si gılals to th motor The E Tne E sit for fr Is lined cliuin & has with ci • penstuiic vvaves The praietal lobe specializes in motor activity, personality, .and speech The scrotum keeps the testicles outside the body so they can be 1 degree cooler than normal core .temperatura The uterus: a thin muscular pouch about the size of an almond that lies in the abdominal cavity posterior toEosin Y Test solution procedure in preparation
- Experimental Methyl Orange at 460 nM Codcentratidn Tube Absorbadce 0-175 0.236 O.079 0-156 2. uanown. mixture ne Experiment reading of Poromophenol blue Solustion of 580nm Concentration. Tube losurbance 0.238 e.065 248 3 0-343 2-280 is uknown masture Value given = lomg methyl Orange 1. 2. 34 15 Bromophenr Autilled water 4 Orstuied 4 13 10 (2)1:07 < Вack Untitled 6 Brownian movement of bacteria: O a. Can be observed by the of soft agar technique O b. Can be observed by staining of Staphylococcus aureus Oc. Is common in Escherichia coli or Proteus vulgaris O d. Is common in Staphylococcus aureus O e. Can be observed at the edge of a microscope CLEAR MY CHOICEd/e/1FAIpQLSfTle9UfP15_VUqFI-ACEQd1XBykXv5Lr4dEMQbLJ1d6fCupw/viewform Students subjected three samples of five different molecules to gel electrophoresis as shown in Figure 1 A B C DE +2 3 Wells 4 8. Which of the following statements best explains the pattern seen on the * gel with regard to the size and charge of molecules A and B? 1 point molecules A and B are positively charged, and molecule A is smaller than molecule B. molecules A and B are positively charged, and molecule A is larger than molecule B. molecules A and B are negatively charged, and molecule A is smaller than molecule B. molecules A and B are negatively charged, and molecule A is larger than molecule B. Sign out