Vhich of the following describes the DNA molecule? A DNA molecule is single-stranded and is composed of phosphate and two nitrogenous bases (thymine and cytosine) that follow complementary base pairing rules T-C. A DNA molecule is double-stranded and is composed of sugar, phosphate, and four nitrogenous bases (adenine, thymine, cytosine, guanine) that follow complementary base pairing rules A-T and C-G. O A DNA molecule is single-stranded and is composed of sugar and four nitrogenous bases (adenine, thymine, cytosine, guanine) that follow complementary base pairing rules A-G and C-T. A DNA molecule is double-stranded and is composed of sugar and two nitrogenous bases (adenine, and guanine) that follow complementary base pairing rules A-G.

Q: 3. Use the 15 molecules illustrated below to answer the following question. Nucleotides consist of a…

A: The basic structure of nucleotides is shown below:

Q: A particular triplet of bases in the coding sequence of a DNA strand is AGT. What is the…

A: Most of the animals have ‘Deoxyribonucleic acid’ (DNA) as their genetic material. Some lower…

Q: If one strand of DNA has a sequence of TCAG, then the sequence of bases on the complementary strand…

A: DNA is double stranded where the two strands are antiparallel and follows complementary base…

Q: In the sugar molecule on a nucleotide, which of the following is correct in regards to how a DNA…

A: DNA and RNA are the genetic material present in the cell. DNA stands for deoxyribonucleic Acid. RNA…

Q: Which of the following properties applies to DNA structure? Contains A, C, G, and U base pairs…

A: Nucleic acids are also called as polynucleotides, are made up of three components: nitrogenous base,…

Q: What parts of the nucleotides are joined together?

A: Nucleotides are composed of phosphate, sugar and nitrogenous bases. Nucleotides are joined together…

Q: In order to change the linking number of a closed circular double-stranded DNA molecule, which of…

A: The linking number of a DNA molecule specifies the number of helical turns in a closed circular…

Q: 1. Draw an accurate segment of DNA with its complimentary strand. (10 points) Make sure to include…

A: DNA (Deoxyribose :Only acts as genetic material.Polynucleotide (monomeric unit is…

Q: 8 10 4 1 O SSDNA O All Polynucleotides QUESTION 6 The carbon labeled in the structure below is the…

A: The given structure indicates an ATP nucleotide. Nucleotides are the basic structural units of a…

Q: sequence of amino acids.

A: The central dogma of molecular biology is the concept which explains the flow of genetic…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: On the diagram of this DNA molecule, match the letters to the corresponding components: (should only…

A: In the diagram below DNA is shown. DNA is made up of a monomer called nucleotide. Each nucleotide…

Q: 15. Adenine (A) pairs with Guanine (G) pairs with

A: asked for 15 so answered 15 th question. DNA is the nucleic acids present in the organisms. DNA is…

Q: Why are nucleobases in nucleic acids called "bases"?   1. Because they resemble baseball bases…

A: Nucleobases : Purine(A,G), pyrimidine(T,C) Purines hydrogen bonds with pyrimidines A double bond T G…

Q: VI. Erwin Chargaff (Early 1950s) 14. What is the difference between a purine and pyrimidine?

A: BASIC INFORMATION  DNA It stands for deoxyribo nucleic acid.  It is the genetic material of all…

Q: In which direction is DNA synthesized and in which orientation relative to its template? O 3'->5';…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: - sequence is there an error in the DNA

A: The advent of technology has lead to discovery of structure of DNA by Watson and Crick in 1950. This…

Q: What is the primary chemical difference between deoxyribose and ribose? Ribose contains fewer…

A: ANSWER;- d) Ribose contains more hydroxyl groups than deoxyribose EXPLAIN;- The ring is made of four…

Q: elect one: DA. A & B Which structures labelled in the diagram above are held together by hydrogen…

A: A polymer made of two chains of polynucleotide wrapped around one another to create a double helix…

Q: 7.) Give the base sequence of the complementary strand of DNA in this molecule. Label the 5' and 3'…

A: DNA is also called as Deoxyribonucleic acid which is an polymer composed of two polynucleotide…

Q: . the position that distinguishes between DNA and RNA is 2. the carbon that the phosphate group…

A: 1. The position that distinguishes between DNA and RNA is A sugar called ribose is found in RNA,…

Q: Fill in the table below Monomeric units are called: What are unique monomeric units? Linkages…

A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…

Q: DNA synthesis

A: DNA: It is deoxyribonucleic acid which is a double-stranded nucleic acid which contains genetic…

Q: Which of the following best describes this nucleic acid? 6. The diagram below shows a portion of a…

A: A single nitrogenous base in RNA (uracil) differes from that of DNA as DNA contains thymine instead…

Q: How many hydrogen bonds are holding together the two strands in this double-stranded DNA molecule? 5…

A: Introduction  The nitrogenous base is A molecule with the chemical characteristics of a base and…

Q: DNA is made up of Group of answer choices guanine, thymine, deoxyribomucleic acids Guanine,…

A: Deoxyribonucleic acid (DNA) is a molecule that contains the biological directions that make every…

Q: In the sequence 5'-TCCGGA-3, an available phosphate group would be found at the 5' end of the…

A: Introduction: A nucleotide is an organic molecule that consists of a nitrogenous base, pentose…

Q: VI. Erwin Chargaff (Early 1950s) 14. What is the difference between a purine and pyrimidine? 15.…

A: Step 1 Nitrogen bases are nitrogen containing heterocyclic ring compounds of two types, substituted…

Q: 1. Nucleotides make up DNA.  List the three parts of a nucleotide. The three parts of a nucleotide…

A: As per our policy, We are answering only question 1. For the rest of the questions please repost.…

Q: Going from simple to complex, which of the following is theproper order for the structure of DNA?a.…

A: Deoxyribonucleic acid (DNA) carries the genetic information in almost all organisms. The DNA…

Q: What is complementary base pairing in the DNA molecule or when RNA interacts with DNA? O C always…

A: Introduction :- The Central Dogma of Biology is a widely accepted principle that describes the flow…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.