using C++* *please include output, Thank you* Using a class and two strings print : Hello, there Hello, Peter Use: thread
Q: Write a program that reads the student information from a tab separated values (tsv) file. The…
A: C++ codeCode screenshotInput file screenshotOutput file screenshot
Q: // JumpinJava.cpp - This program looks up and prints the names and prices of coffee orders. //…
A: Answer: Note: Two possible solutions are provided as no output or output format was specified,…
Q: BEGINNER C++: Hello, I have the programming assignment below and was wondering if I can get some…
A: Code #include<iostream>using namespace std; const int ROWS=3;const int COLS=3;void…
Q: Create a Rati mo
A: ANS- Source code- #include<iostream> // #include<conio.h> using namespace std; class…
Q: Divide method in the polynomial.cpp
A: void main(){ int poly[10], m, r, i, q[6];…
Q: in c++ Write a program to generate a random number between 1 - 100, and then display which quartile…
A: This question explains about C++ program Program Guidelines: Utilize the header records,…
Q: Using C++ how can I use Binary Search Tree (BST) to update a file. The code needs to be a…
A: Summary :-We got the output.
Q: C++ Sort Characters by Frequency, Case, Alphabet Khalid like to play with strings. He has a list of…
A: ALGORITHM:- 1. Take input for the strings from the user. 2. Pass it to the function. 3. Display the…
Q: C++ Exercise 1: If the file circuit.txt contains the following data 3.0 2.1 1.5 2.6 13 13 2 2 50 21…
A: Here is the c++ code of above problem. See below steps for code.
Q: #include #include using namespace std; int main() { // Declare variables. string…
A: #include <iostream> #include <string> using namespace std; int main() { // Declare…
Q: Programming language: c++ (1) Prompt the user for a string that contains two strings separated by a…
A: Programming Approach: Including necessary header files. Remove leading and trailing spaces. Splits…
Q: Create a C program that forks itself. * * One part will ask the user to enter a number. * The…
A: Create a pipe to establish communication between parent and child processes.Fork the process to…
Q: Write a program that replaces the second letter of every word in char string A with the third letter…
A: Approach Start Include header file Main class Declare variables Input the first word Display the…
Q: C Standard Library The C library stdio.h provides several key input/output functions. For questions…
A: All the Function of Stdio.h is given in next step
Q: def test_func(a,b,c): return (a+b)/c This function is normally designed to be used with three…
A: Find the required code in python given as below and output:
Q: The Assignment Assume you're trying to build an e-mailing list by analyzing some random text data…
A: Algorithms: START create cleanup methodWrite all prosses Create the main method while…
Q: Create a program and then: Show file input (get your input from a file) File output (output to a…
A: Below i have given code for same:
Q: C++ Program to check if a file or more is sorted or not? What would be the best way to check that…
A: #include <iterator>#include <algorithm>#include <vector>#include…
Q: Write the following code: 1. Declare a variable named hasNext. 2. Assign hasNext the value true. 3.…
A: Introduction:- bool data type supports storing values true and false. To store data values of…
Q: C++ Program #include #include #include #include #include using namespace std; // Provided…
A: #include <iostream> #include <string> using namespace std; typedef struct Result {…
Q: Merge two files (1 point) Write a program that reads the content of two files “text1.txt” and…
A: Actually, file is a sequence of bytes where related data stored.
Q: HELP PLEASE: HOW DO I COMPLETE THIS IN C PROGRAM?????? This code will require some code…
A: The correction for the above code is in the main function. The main function is
Q: USING C++ PLEASE CREATE THREE FILES! NumberGuesser.h: NumberGuesser class definition…
A: main.cpp: #include <iostream>#include"NumberGuesser.h"using namespace std; int main(){ int…
Q: Common Time Zones Function Name: commonTimeZones() Parameters: code1( str ) , code2( str )…
A: Hey there, I am writing the required solution of the questin mentioned above. Please do find the…
Q: Doubly Linked List (C Language, without headers) This assignment asks you to sort the letters in an…
A: Step 1: Declare struct node that stores data, prev pointer and next pointer.Step 2: Define main()…
Q: Data Structures the hasBalancedParentheses () method. Note: this can be done both iteratively or…
A: NOTE: Only function is provided as per the question, and not the complete code. c++ function code:…
Q: 6330 ı you wir e tU WI e your aLateeLa. Instructions Lilal 1. Study the prewritten code to make…
A:
Q: C++ Overload the ~ operator to return the reversed elements of a String: Operator Call Resulting…
A: Explanation: To over-loading the tilde(~) administrator, make a class and make the over-burdening…
Q: C++ Programming. Theme: Standard string manipulation functions - string concatenation, comparison,…
A: Program Approach:- 1. Include header files 2. Create the user-defined function whose name is…
Q: 4th Edition P767 2(d) Use your wits to construct a DFA for the following regular expression: ab* +c…
A: According to the Question below the Solution:
Q: read the lines of the file until it reaches the end, print out the last line in the file, report the…
A: def print_last_line(fname): f = open(fname, "r") count = 0 for line in f: count += 1…
Q: Fix all the errors and send the code please // Application looks up home price // for different…
A: After removing error, the resulting Java codes are: import java.util.*;public class DebugEight3{…
Q: Write a program that prints a menu of choices: L -> Find the lowest value in a file H -> Find the…
A: Here I written C++ code for given problem below. I hope you like it.
Q: Function Name: commonTimeZones() Parameters: code1( str), code2( str) Returns: list of common time…
A: Hey there, I am writing the required solution of the questin mentioned above. Please do find the…
Q: Part 1 - Write Code Jse Java or C or C++ to write an echo program. Name your source code file repeat…
A: Step 1 : Start Step 2 : Here we need to Declare a string variable to store the entered Text in it.…
Q: USING FILE HANDLING FUNCTIONS READ THE INSTRUCTIONS IN THE IMAGE BELOW, THANK YOU YOU CAN ALSO…
A: #define MAX 50 #include <stdlib.h> #include <stdio.h> #include <string.h> struct…
Q: How to make this run? // Flowers.cpp - This program reads names of flowers and whether they are…
A: Solution: Once you've got your compiler and source program ready, it is very easy to compile and run…
Q: python question: Write a code that takes a sentence as an argument and places its words in a list…
A: #method that takes sentence as argument and places its words#in a list in alphabetical order and…
Q: Rest of code in image / This is a bad programming style since it is using goto. // This is an…
A: The ask is to make the given program menu-driven with the different functions and errors resolved.
Q: Suppose the file nums.txt contains the following data: 15 9 -11 22 -7 -18 21 20 -19 12 Suppose…
A: In the given code simply reading each element from the file into num variable if(num%2==1) means…
Q: C++ Programming. Associative and unordered associative containers. Associative containers (set,…
A: Answer to the above question is given below
*using C++*
*please include output, Thank you*
Using a class and two strings print :
Hello, there
Hello, Peter
Use: thread
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 4 steps with 2 images
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- C++ Add a search command that asks the user for a string and finds the first line that contains that string. The search starts at the first line currently displayed and stops at the end of the file. If the string is found, the line that contains it is displayed at the top. In case the user enters a string X that does not occur in the file, the program should print the error message: ERROR: string "X" was not found.Please fill in the blanks. /* This function asks for 2 strings from the user and asks the user to choose what they want to do with them. Inputs: 2 strings, and a character for choice. Output: execute that choice. Choices can be: 'E'/'e': call checkEqual() function 'C'/'c': call concatStrings() function Everything else: invalid and exit */ #include<__1__> //library to use printf and scanf #include<__2__> //library to use boolean #include<__3__> //library to use exit(0) #define len 1000 /*This function just concatenates 2 strings using a */ __4__ concatStrings(__5__ w1[], __6__ w2[], __7__ w3[]) { int w3_idx = 0; //index for w3 //Copy word1 w1 over to the combined string for(int i = 0; __8__ != __9__; i++) //loop runs as long as string is not done { __10__[__11__] = __12__[__13__]; //copy a character from w1 to w3 w3_idx++; //update…Given: string s; int first, last; Write code to repeatedly validate that first is less than last and both first and last are valid indexes of the string s. Then print all characters of the string s from index first to last inclusive. Example Output 1 Enter a string and two indexes: Queensborough 25 eens Example Output 2 Enter a string and two indexes: Science 2 10 Enter a string and two indexes: Science -15 Enter a string and two indexes: Science 2 4 ien
- USING C++ PLEASE CREATE THREE FILES! IntCollection.h (or IntCollection.hpp): class definition IntCollection.cpp: class implementation main.cpp, including sample output and your answer to question 6 at the bottom. : main program to run the code The following code creates an IntCollection object named ‘c’. It adds seven integers to ‘c’, then uses a for loop to display the seven integers: int main() { IntCollection c; c.add(45); c.add(-210); c.add(77); c.add(2); c.add(-21); c.add(42); c.add(7); for (int i = 0; i < c.getSize(); i++) { cout << c.get(i) << endl; } } For this assignment you will add a copy constructor, a destructor, and three overloaded operators to the IntCollection class. In the design diagram below, the black member functions represent code that has already been implemented. You will be implementing the green items. Each item that you will be adding to the class is described below the diagram. private: int size // the number of ints currently stored in…C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…c++ proble. Please paste ur indented code here
- Answer the given question with a proper explanation and step-by-step solution. 1- Write code that does the following: opens an output file with the filename number_list.txt, uses a loop to write the numbers 1 through 100 to the file, then closes the file.Instructions The python "try" keyword is very powerful in that it can, among other things, prevent a program from ending abnormally because of invalid numeric input. Write a python program with two functions/modules that does the following: .main() accepts input and calls a function to test if the input is a number and displays a message regarding the result of that numeric test • numTest() is passed an input string, tests to see if the string is numeric and returns the necessary information to main() . a NULL input (just pressing the enter key) ends the program . DO NOT USE THE BUILTIN PYTHON FUNCTION FOR NUMERIC TESTING Be sure to use clear prompts/labeling for input and output.Write the countVowels function which counts the number of vowels using the string class as follows: int countVowels(const string& s) Write a test program that prompts the user to enter a string, invokes the countVowels function and displays the total number of vowels in the string.
- Exercise #2 Frequency Analysis: One of the oldest approaches to breaking a code is to perform a frequency count of letters. Write a C++ program to perform a frequency count by reading the text from a file (code.txt). Your program should output how many A's are there in the text, how many B's are there, and so on. Note that the program will not make any distinction between uppercase and lowercase letters. It will output the results to the screen and in a text file (count.txt) Sample output (for code.txt): A: 3 B: 3 C: 23 D: 13 E: 41 F: 4 G: 9 H: 15 1:44 J: 1 K: 0 L: 7 M: 9 N: 33 O: 16 P: 4 Q:0 R: 22 S: 24 T: 27 U: 8 V: 5 W: 1 X: 0 Y: 4 Z: 0Code below will not create the file needed for the descrambling word game below: Help me create the file needed to complete the game in C++ and make the game timed. #include <iostream>#include <algorithm>#include <fstream>#include <string> using namespace std; string sortString(string word){ transform(word.begin(), word.end(), word.begin(), ::toupper); sort(word.begin(), word.end()); return word;} void jumbledString(string jumble){ string checkPerWord = ""; string userEnteredAfterSorting; userEnteredAfterSorting = sortString(jumble); ifstream word("Game.txt"); if (word) { while (getline(word, checkPerWord)) { string Ch = sortString(checkPerWord); if (Ch == userEnteredAfterSorting) { cout << checkPerWord << endl; } } word.close(); }} int main(){ string string = "tac"; jumbledString(string); return 0;}int main1(){ string string =…c++ program need help You are given a file containing many words. Read in all of the words from the file and insert each word into a searchable ADT. Give the user a looping menu allowing them to search for words in the word list. Searches must be be found in O(1) or constant time. Your code must time the search operations, and display the time to the user. For this assignment, you may use the provided word list or another word list with more than 150,000 words. Include this file with your submission. You must design and implement the following classes: Word: This class holds a single word as a string. Basic getters and setters are required. HashTable: This class represents the hash table for storing many words. Main: This is the driver class. The driver: Create a Hash Table Read in all of the words from a text file into the Hash Table Provide a looping menu for the user to perform searches. Time all searches and display the execution time to the user For each search: Prompt…
![Database System Concepts](https://www.bartleby.com/isbn_cover_images/9780078022159/9780078022159_smallCoverImage.jpg)
![Starting Out with Python (4th Edition)](https://www.bartleby.com/isbn_cover_images/9780134444321/9780134444321_smallCoverImage.gif)
![Digital Fundamentals (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780132737968/9780132737968_smallCoverImage.gif)
![C How to Program (8th Edition)](https://www.bartleby.com/isbn_cover_images/9780133976892/9780133976892_smallCoverImage.gif)
![Database Systems: Design, Implementation, & Manag…](https://www.bartleby.com/isbn_cover_images/9781337627900/9781337627900_smallCoverImage.gif)
![Programmable Logic Controllers](https://www.bartleby.com/isbn_cover_images/9780073373843/9780073373843_smallCoverImage.gif)
![Database System Concepts](https://www.bartleby.com/isbn_cover_images/9780078022159/9780078022159_smallCoverImage.jpg)
![Starting Out with Python (4th Edition)](https://www.bartleby.com/isbn_cover_images/9780134444321/9780134444321_smallCoverImage.gif)
![Digital Fundamentals (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780132737968/9780132737968_smallCoverImage.gif)
![C How to Program (8th Edition)](https://www.bartleby.com/isbn_cover_images/9780133976892/9780133976892_smallCoverImage.gif)
![Database Systems: Design, Implementation, & Manag…](https://www.bartleby.com/isbn_cover_images/9781337627900/9781337627900_smallCoverImage.gif)
![Programmable Logic Controllers](https://www.bartleby.com/isbn_cover_images/9780073373843/9780073373843_smallCoverImage.gif)