Use the Flex (a fast lexer generator) to generate a lexer. Flex is the tool for generating lexers.Flex implements the algorithm that convert RE to NFA and NFA to DFA for you. So, you onlyneed to write an input source Flex file (filename.I), where you specify a specification of patterns(called rules) of the lexer using Regular Expressions and C code.You are expected to:1. Describe the skeleton of an input Flex source file (filename.l) and theirfunctionalities. Three sections in the file: definitions, rules and user routines.%{Declaration SectionDefinitions section%%Rules SectionUser routines Section m■2. Program and implement Flex. Know the working steps of Flex as below.Flex SourceFile(sample 1)FlexCompiler(Flex)Input TextFileLexical AnalyzerCode (lex.yy.c)C CompilerLexical AnalyzerexecutableOutput: TokensParsersample.I is a Flex source file containing the specification (rules) in the form of pairsof regular expressions and C code, for identifying tokens in the input text file.lex.yy.c defines a scanning routine yylex() that uses the specification to recognizetokens.Lexical analyzer executable is actually the lexer/scanner program (a.out/ .exe)!Requirement of submission part: your final submission to Canvas must have Four (4) files:the given "input_soucecode.txt", your Flex (.) file, output file (saving the result into two columns,one for tokens and another for lexemes, name it as "output". See the example in above option 1),and a readme file (including a brief instruction and commands i.e., how to set up and run yourprogram).

Flex is a tool which is use to generate scanner.Scanner is a program or software that recognizes…

Use the Flex (a fast lexer generator) to generate a lexer. Flex is the tool for generating lexers. Flex implements the algorithm that convert RE to NFA and NFA to DFA for you. So, you only need to write an input source Flex file (filename.I), where you specify a specification of patterns (called rules) of the lexer using Regular Expressions and C code. You are expected to: 1. Describe the skeleton of an input Flex source file (filename.) and their functionalities. Three sections in the file: definitions, rules and user routines.

Use the Flex (a fast lexer generator) to generate a lexer. Flex is the tool for generating lexers. Flex implements the algorithm that convert RE to NFA and NFA to DFA for you. So, you only need to write an input source Flex file (filename.I), where you specify a specification of patterns (called rules) of the lexer using Regular Expressions and C code. You are expected to: 1. Describe the skeleton of an input Flex source file (filename.) and their functionalities. Three sections in the file: definitions, rules and user routines.

Computer Networking: A Top-Down Approach (7th Edition)

7th Edition

ISBN:9780133594140

Author:James Kurose, Keith Ross

Publisher:James Kurose, Keith Ross

Chapter1: Computer Networks And The Internet

Section: Chapter Questions

Problem R1RQ: What is the difference between a host and an end system? List several different types of end...

See similar textbooks

Similar questions

You guys use AI tool to answer. Last time I found plagiarism and AI detection in my answer. Now If you will use these things I'll surely give multiple downvotes and will report ⚠️ sure.
DateType keeps only the integer representation of the month,day, and year. When a month is wanted in string form, the string iscalculated. An alternate approach would be to add a string field tothe date and calculate and store the string representation in theInitialize function. Which methods would have to bechanged? Would this change make the use of an if statement tofind the appropriate string more or less attractive? Write the code in C++for this if statement.
Using C++ Using your own creativity, make a set of function templates that have these features: This function must return a value. A function template with 1 template parameter, T. And, any other parameters you want. A function template with 2 template parameters, T1 and T2. And, any other parameters you want Within main (): Call your template functions and demonstrate how they work. Construct objects and show off your amazing programming skills!
Could I get an example of a program writen in C that uses qsort() to sort its command line vector argv by the length of the strings? This is part of my first project and I don't understand pointers very well. If you have a video on how it is done that would work too. I looked at the meterial provided to me and I still cant rap my head around it. If this is to big of a question if you could baby step me through how pointers work that would be a great help. Thank you
in C program please
in c++ code
Help with this. Solve the Heads-or-Tails problem in C or C++. Read the H-or-T data from either a file or from STDIN. Reportthe result and related statistics to STDOUT. Report any errors to STDERR:a. In an effort to find something to do during self-quarantine, your friend flips a coin many times andcarefully records the result of each flip in a character vector using either H or T. Write a functionprogram called longestRun that reads these characters from a file and then analyzes them to find thelargest number of consecutive heads or tails. It must return/display two values: (1) the numbercorresponding to how many max consecutive heads or tails were thrown in a row and (2) thecharacter H or T depending upon whether it was Heads or Tails that was thrown the most times. Inthe event of a tie for the longest run, return the character B for both the text file is HTHHTTTHHTHHHTHTHTHHHHHTTHHHHHHHHHHHHTTTTTTTTTH
Provide Full C++ Code In this checkpoint, your goal is to find the longest consecutive sequence of a STR (Short Tandem Repeats) in a DNA sequence. The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence. For example, if input sequence is: AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA then numOccurrences("AGAT", sequence) should return 5 numOccurrences("TATC", sequence) should return 8 if input sequence is: AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG then numOccurrences("AATG", sequence) should return 7 numOccurrences("TATC", sequence) should…