Provide Full C++ Code In this checkpoint, your goal is to find the longest consecutive sequence of a STR (Short Tandem Repeats) in a DNA sequence. The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find

Provide Full C++ Code

In this checkpoint, your goal is to find the longest consecutive sequence of a STR (Short Tandem Repeats) in a DNA sequence.

The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence.

For example,

if input sequence is:

AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA

then

• numOccurrences("AGAT", sequence) should return 5
• numOccurrences("TATC", sequence) should return 8

if input sequence is:

AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG

then

• numOccurrences("AATG", sequence) should return 7
• numOccurrences("TATC", sequence) should return 4

if input sequence is:

CAGATAGATAGATAGATAGATAGATGTCACAGGGATGCTGAGGGCTGCTTCGTACGTACTCCTGATTTCGGGGATCGCTGACACTAATGCGTGCGAGCGGATCGATCTCTATCTATCTATCTATCTATCCTATAGCATAGACATCCAGATAGATAGATC

then

• numOccurrences("AGATC", sequence) should return 1

----------------------------------------

#include <iostream>
#include <string>
#include <vector>
using namespace std;

/**
 * function to find the longest consecutive sequence of Short Tandem Repeats (STR) in a DNA sequence 
 * 
 * @param   STR   the string storing the Short Tandem Repeat
 * @param   sequence         the string storing the DNA sequence
 * @returns  the length of the longest consecutive sequence of STR in the DNA sequence
 **/
 
int numOccurrences(string& STR, string& sequence)
{
   //For Checkpoint A, you only need to add logic to this function
   
   //FIXME
   return 0;  
}

int main(int argc, const char * argv[]) {

   // ****** STOP: DO NOT CHANGE THIS FUNCTION FOR THIS CHECKPOINT *******
   
    string sequence, STR; //strings storing the DNA sequence and the Short Tandem Repeats (STR)
    
   //Read sequence and STR from standard input
    cin >> sequence;
    cin >> STR;
    
    //Determine the length of the longest consecutive sequence of STR in the DNA sequence
    int num = numOccurrences(STR, sequence);
    
    //Print out the length
    cout << num << endl;
    
}