urine collecting duct Question 6 Which of the following is true of benign prostatic hyperplasia? OIt is usually caused by a viral infection. It is a severe cancerous condition. It can constrict the urethra. All of the above are true.

Q: CN12 Hypoglossal

A: The twelve pairs of nerves that arise from the brain and function to connect the brain with several…

Q: Innervates the superior oblique muscle of eye Only cranial nerve that extends beyond the head and…

A: Twelve nerves make up the cranial nerves. They come from the brain and have direct connections to…

Q: Right upper and lower facial weakness signifies right upper motor neuron damage.. TRUE OR FALSE

A: Facial palsy refers to the weakness observed in the facial muscles of an individual. It occurs…

Q: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA

A: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA Know that, The Adenine is always pairs…

Q: . What would be the consequence of an inactivating mutation in the HO gene in an a cell? [Select]

A: Inactivating mutation This mutation is also called as loss of function mutation. The product of this…

Q: When most people refer to a "spinal nerve" they are actually talking about the. O anterior ramus…

A: Spinal nerve: The part of the peripheral nervous system includes the spinal nerve. There are 31…

Q: 10 um PHASE ORDER (1-5)

A: Cell division is a phenomenon in which cell undergo process of division so as to form new daughter…

Q: I’m Spanish and I’m learning English. I received this email from my professor: I will be out…

A: It's a future tense in English  , yes ,  no class tomorrow .

Q: Cell body of somatic motor neuron Cell body of an ANS preganglionic neuron Cell body of an ANS…

A: The autonomic nervous system is referred to as the ANS. It is a division of the peripheral nervous…

Q: Aphakia and it's correction

A: Eye- The eye is one of the sense organs of the body which is used for seeing different objects. The…

Q: name the feature (blue circle)

A: The skeletal system is one of the 11 major body organ systems that are concerned with various…

Q: Lebel 1

A: We know that It is the largest bone in the body. It is the bone present on the upper end of the body…

Q: Which number is triceps brachii

A: Locomotion and movement of our body are carried out with the help of muscles and bones. Muscles…

Q: What is the difference between DM and DI?

A: Hello there ,  Antidiuretic hormone (ADH), commonly referred to as vasopressin, levels are what…

Q: HR VS Sem's O 150 005 Rhythm fifififif 1252, 20 jufifufuful

A: ECG states electrocardiogram. It is a non invasive diagnostic procedure. It is used to record the…

Q: 2. Next, directly below the new DNA sequence that you gave for #1, write/type the nucleotide…

A: 2. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: No explanation, just need name. please answer all Name the movements of the neck and the trunck…

A: Introduction: The human body is divided into the following regions: Head and neck Upper limbs…

Q: 8. Define a reflex. Name the five components of a reflex arc, and explain its operation.

A: Reflex action controls a number of body activities, it gives response to harmful stimulus very…

Q: All of the following characteristics describe the Anatomical Position, EXCEPT: Palms Facing the Body…

A: Superior or cranial - towards the end of the body's head; upper part; (example, the hand is part of…

Q: 11. Describe the spinal cord gray matter, where are sensory and motor neurons located in the gray…

A: he Brain is the body's largest and most complicated organ, made up of many (>100 billion neurons)…

Q: Awkward posture Reasons why?

A: Good posture involves training the body to stand, walk, sit and lie in positions where the least…

Q: 0

A: The digestive tract starts from the mouth and finishes at the rectum. The digestive system of the…

Q: Frog muscular system. Identify numbers 2, 4, 6, 8

A: Introduction:- Frogs rely upon a few sorts of muscles to do their ordinary everyday exercises, for…

Q: Can u please explain the steps to do this .thanks !

A: 1 gram of carbohydrate contains 4 calories,  1 gram of protein contains 4 calories,  1 gram of fat…

Q: Label_.

A: The excretory system is the part of an organism's body that is responsible for excretion or the…

Q: 3. 9, 2

A: The diagram represents the lymph node. It is a small swellings in the lymphatic system. The lymph is…

Q: In The Day of the Triffids, after most people in the world are blinded by an apparent meteor shower,…

A: The alleles are generally of dominant and recessive type and some other forms like codominant are…

Q: Fibrocartilage (____×)Location _______________________ Function _______________________

A: As we know human body is made of skeleton. Skeleton is structure that keeps body in shape and helps…

Q: There are only two things to remember.  Number One... Don't Stop, and Number Two... Keep Going!”…

A: Frank Zappa's advice encapsulates the essence of perseverance and resilience. It reminds us that…

Q: Which letter represents the corpus spongiosum? -B -D OD O A CDE

A: Introduction: The male reproductive system comprises the following: A pair of testis Accessory…

Q: attach

A: The given diagram is of ANTIGEN PRESENTATION to a defence cell of the body so that it recognises the…

Q: What do the palmar arches supply blood to? One word.

A: The human circulatory system is responsible for the circulation of blood through the body. It is…

Q: Epistasis Epistasis is when a gene will interfere or hide expression of another gene. In Labrador…

A: Epistasis is the phenomenon of the gene mutation where presence of one of the alleles masked the…

Q: What is the Fischer projection of the nonulose structure above? H OH H OH HOH HOH H OH HOH H OH HOH…

A: The fischer projection of given nonulose structure is..  fischer projection is 2-D image of 3-D…

Q: Letter D please what is called!

A: The smallest structural and functional unit of an organism is known as cell which contain different…

Q: im confused, what is the answer?

A: The root system and the shoot system are the two main structures in plants. Every one of these…

Q: may u break it down a little more please

A: Integumentary system :  Integuments are the largest system of the body. It includes skin and its…

Q: sign (+) for positive and a "minus" sign(-)

A: Carbohydrates Proteins Lipids Elements C; O, and H C; H; O; N       P, S C; H; O Ratio of H: O…

Q: 13.

A: We can say that Pronunciation is the manner by which a word or a language is spoken. This might…

Q: A B с

A: The anatomical planes can be considered to be a hypothetical planes that helps in understanding the…

Q: OH NaOH

A: Fatty acids are long chain carboxylic acids. Here we are looking at the reaction between a free…

Q: H. Identify the labeled parts of the reflex arc. (Choose) TChoose Choose (Choo (Chooie (Chooe Choe

A: