Traceback (most recent call last):File "C:/app.py", line 20, in main()File "C:/app.py", line 17, in mainprint_report()File "C:/app.py", line 12, in print_reportprint_id()File "C:/app.py", line 6, in print_idmessage = "Your id is:" + id numTypeError: must be str, not intProcess finished with exit code 1Given this stack trace above, on what line was the exception raised?O Line 17O Line 12O Line 6O Line 20

EXCEPTION:The exception is a `TypeError`. It occurred because there was an attempt to concatenate a…

Answered: Traceback (most recent call last): File…

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

IN C++ Write a program that represents a playlist on a video streaming service. Each video has a title and total minutes. The user should be able to do the following with the playlist: Add video to list Remove video from list Display list in alphabetical order by title Exit playlist Your driver file will need a storage object that can handle any amount of videos. You will also need to provide a menu that shows and performs the various options above. The menu should continue to display until the user selects the "Exit playlist" option. A description of each menu option is listed below: Add video to list Prompts the user for a video title and total minutes Then your code stores the video onto the storage object of your choice Remove video from list Prompts the user for a video title Then your code removes that video from your storage object Display list in alphabetical order Displays the video's title and total minutes for each video in your storage object. Sample format:…
0110 earlier_name Complete the following function according to its docstring description. 1 def earlier_name(name1: str, name2: str) -> str: 2. *"Return the name, name1 or name2, that comes first alphabetically. >>> earlier_name ('Jen', 'Paul') 4 'Jen' >> earlier_name('Colin', 'Colin') 7 "Colin' Submit History LO
for c++ need 3 files please all three files (character.h, castle.h, 81.cpp) you have been asked by a computer gaming company to create a role-playing game, commonly known as an rpg. the theme of this game will be of the user trying to get a treasure that is being guarded the user will choose a character from a list you create create a character class, in a file named character.h, which will: have the following variables: name race (chosen from a list that you create, like knight, wizard, elf, etc.) weapon (chosen from a list that you create) spells (true meaning has the power to cast spells on others) anything else you want to add the treasure will be hidden in one of the rooms in a castle create a castle class, in a file named castle.h, that will: have these variables: at least four rooms named room1, room2, etc. moat (which is a lagoon surrounding a castle) which boolean (not all castles have them) anything else you want to add create a default constructor for each class that…
C++ This program does not compile! Spot the error and give the line number. Presume that the header file is error free and // Implementation file for the Rectangle class.1. #include "Rectangle.h" // Needed for the Rectangle class2. #include <iostream> // Needed for cout3. #include <cstdlib> // Needed for the exit function4. using namespace std; //***********************************************************// setWidth sets the value of the member variable width. *//*********************************************************** 5. void Rectangle::setWidth(double w){6. if (w >= 0)7. width = w;8. else{9. cout << "Invalid width\n";10. exit(EXIT_FAILURE);}} //***********************************************************// setLength sets the value of the member variable length. *//*********************************************************** 11. void Rectangle::setLength(double len){12. if (len >= 0)13. length = len;14. else{15. cout << "Invalid length\n";16.…
A for construct is a loop construct that processes a specified list of objects. As a result,it is executed as long as there are remaining objects to process. True or False?
PLEASE COMMENT CODE In a python program, create a new file and call it “ tracking”. Write to it four lines each contains information about an order like this: 1-00654-021 Dell charger Toronto-WEST 99-49-ZAD011-76540-022 ASUS battery Milton-EAST 34-56-CBH561-09239-026 HP HD Scarborough-NORTH 12-98-AZC451-12349-029 Mac FD North York-LAWRENCE 34-49-ZWL01Add the file two more lines: 1-34567-055 Lenovo SSD Milton-ON 34-09-MT04 1-90432-091 Lenovo battery Oakville-ON 78-KL98 Define a function that searches for a brand (e.g. Dell, ASUS, etc.). Test the function in your program.
Assignment Submission Instructions:This is an individual assignment – no group submissions are allowed. Submit a script file that contains the SELECT statements by assigned date. The outline of the script file lists as follows:/* ******************************************************************************** * Name: YourNameGoesHere * * Class: CST 235 * * Section: * * Date: * * I have not received or given help on this assignment: YourName * ***********************************************************************************/USE RetailDB;####### Tasks: Write SQL Queries ######### -- Task 1 (Customer Information):-- List your SELECT statement below. Make sure the SQL script file can be run successfully in MySQL and show the outcome of the code on MySQL
C++ Add a search command that asks the user for a string and finds the first line that contains that string. The search starts at the first line currently displayed and stops at the end of the file. If the string is found, the line that contains it is displayed at the top. In case the user enters a string X that does not occur in the file, the program should print the error message: ERROR: string "X" was not found. Attached is the first lines of the .txt file
I need this done in C++ please! This program implements the top-level menu option 'R' of the Airport Application and constitutes Part 2 of the Airport Application Project requirement. When the user selects 'R' in the airport application, she will be taken to the "page" that is displayed by this program. This program is meant to replace the flight status report program (Programming Assignment 3) that did not use arrays to store the flight status information. It also reads the information from the file token wise.
C++ Add a search command that asks the user for a string and finds the first line that contains that string. The search starts at the first line currently displayed and stops at the end of the file. If the string is found, the line that contains it is displayed at the top. In case the user enters a string X that does not occur in the file, the program should print the error message: ERROR: string "X" was not found.
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
This is a main module. w7_main Module (supplied) Do not modify this module! Look at the code and make sure you understand it. // Workshop 7 // Version: 1.0 // Author: Asam Gulaid // Description: // This file tests your workshop 7 ///////////////////////////////////////////// #include<iostream> #include "Minister.h" #include "Minister.h" // intentional #include "MemberParliament.h" #include "MemberParliament.h" // intentional using namespace std; using namespace sdds; void printHeader(const char* title) { char oldFill = cout.fill('-'); cout.width(62); cout << "" << endl; cout << "|> " << title << endl; cout.fill('-'); cout.width(62); cout << "" << endl; cout.fill(oldFill); } void newElections(Minister& aMinister, const char* district, const char* newPM, double year) { aMinister.NewDistrict(district); aMinister.changePM(newPM); aMinister.assumeOffice(year); cout << "Status of New Election " << aMinister << endl…

SEE MORE QUESTIONS

Recommended textbooks for you

Database System Concepts

Computer Science

ISBN:

9780078022159

Author:

Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:

McGraw-Hill Education

Starting Out with Python (4th Edition)

Computer Science

ISBN:

9780134444321

Author:

Tony Gaddis

Publisher:

PEARSON

Digital Fundamentals (11th Edition)

Computer Science

ISBN:

9780132737968

Author:

Thomas L. Floyd

Publisher:

PEARSON

Database System Concepts

Computer Science

ISBN:

9780078022159

Author:

Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:

McGraw-Hill Education

Starting Out with Python (4th Edition)

Computer Science

ISBN:

9780134444321

Author:

Tony Gaddis

Publisher:

PEARSON

Digital Fundamentals (11th Edition)

Computer Science

ISBN:

9780132737968

Author:

Thomas L. Floyd

Publisher:

PEARSON

C How to Program (8th Edition)

Computer Science

ISBN:

9780133976892

Author:

Paul J. Deitel, Harvey Deitel

Publisher:

PEARSON

Database Systems: Design, Implementation, & Manag…

Computer Science

ISBN:

9781337627900

Author:

Carlos Coronel, Steven Morris

Publisher:

Cengage Learning

Programmable Logic Controllers

Computer Science

ISBN:

9780073373843

Author:

Frank D. Petruzella

Publisher:

McGraw-Hill Education

SEE MORE TEXTBOOKS