The proofreading of DNA is essential for faithful replication. True False
Q: The following structures were introduced as neuromuscular blocking agents. Structure B is derived fr...
A: Here compound A and B both are choline derivative as both have Choline group at both end in the stru...
Q: Explain why oils become rancid. Provide short and concise answer with relevant examples.
A: Fats and oils are made up of triglycerides, which are esters made up of three fatty acid units bound...
Q: QUESTION 2 linkages that O a1 -> 4 glycosidic ; can Cellulose contains be digested by animals, O B1-...
A: Cellulose is a homopolysaccharide of glucose formed by the linkage of beta 1-4 present in between gl...
Q: Based on the structure of CBB G-250, explain why it can bind to proteins having basic and hydrophobi...
A: CBB G-250 (Coomassie Brilliant Blue G-250) is a dye used to visualize proteins. There are two types ...
Q: Refer to the following table below to answer the succeeding questions: Protein Isoelectric pH Molecu...
A: Two dimensional gel electrophoresis is an electrophoretic technique in which in the first dimension ...
Q: G1: CASE ANALYSIS A 28 year old woman is seen with an easy fatigue for a couple of months. She is c...
A: Symptoms mentioned here for 28 years old lady with two babies in 2 years Symptom 1: Taste of eating ...
Q: Discuss the factors that affect the 260/280 ratio
A: The 260/280 ratio is the ratio of absorbance of a sample at 260 nm to its absorbance at 280 nm.. Thi...
Q: Why “might” an obese animal require more vitamin D in their diet than an animal of moderate body con...
A: Vitamin D level is lower in obese people. People who are overweight and obese often get recommendati...
Q: A two-step pathway that is activated by the secretion of glucagon and adrenaline
A: Glucagon and adrenalin, both induce an increase in hepatic glucose levels. However the mechanism of ...
Q: TRUE OR FALSE Palmitic oil is (soluble) to hot ethanol and chloroform.
A: Hi. Thank you for the question. The second question looks incomplete. Please provide the details abo...
Q: 1. How do you prepare 25 mL of a 0.4X solution of SDS from a ...
A: Using formula C1V1= C2V2, we can calculate the Molarity, w/v, %, or any other concentration of the s...
Q: Provide an example where "gradient" acting as a force and driving life
A:
Q: An enzyme following Michaelis-Menten kinetics was found to have highest activity at 37° C and pH 7. ...
A: Values given: temperature: 37°C pH: 7 Maximum velocity or Vmax= 2.4×10-4 mol.lit-1s-1 Enzyme concen...
Q: 2. Explain why enzyme activity declines at (a)high temperature and (b) presence of heavy metal ions.
A: Enzymes are proteins that aid in the speeding up of our bodies' metabolism, or chemical processes. S...
Q: f the cell used one molecule of glucose and there was no loss of energy or intermediates what is the...
A:
Q: Discuss how carbohydrates can be stored as fat. Please answer precisely, clearly, and directly.
A: Carbohydrates are the primary source of energy for the body, and glucose is the simplest form of car...
Q: In Soap experiment(creation), How did soap compare to the commercially prepared soap?
A: Soap is a mixture of oils and alkali along with some natural aromatic compounds and moisturizer and ...
Q: hat is the pH of 0.6M acetic acid?
A: Acetic acid is a weak acid, to calculate the pH we need acid dissociation constant (ka) , for this a...
Q: What are the important considerations that you have to remember in antibody screening?
A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...
Q: Streptococcus pneumoniae cells of genotype str s mtl - are transformed by donor DNA of genotype strr...
A: It is the genetic alteration of a cell resulting from the uptake and expression of foreign genetic m...
Q: For the purpose of energy utilization, what are the advantages of generating energy from lipids as c...
A: Sugars, starch, and cellulose are among a vast group of organic molecules found in meals and biologi...
Q: (Vmax.f [S] - (Vmax,b [P] KM,b [P] vo [S] 1+ KM.f KM.b ||
A: In this enzyme kinetics, I am going assume a general mechanism and then derive the rate equation. As...
Q: CAMP Ga-O GTP OFF GDP Ligand GDP Adenylate Cyclase Ga O ON PKA GTP Mobilie Glycogen stores through g...
A:
Q: ESGU is O Exercise stimulated glucose uptake O Exercise stimulated glucose usage O Due to alternate ...
A: Exercise is the activity or movement which results in the energy utilization or expenditure which pa...
Q: Consider the following statements: (1) Complete hydrolysis of a disaccharide produces only monosacch...
A: Complete hydrolysis of disaccharide produces only monosaccharide. This statement is true. Dihydroxya...
Q: Explain how a phosphate buffer neutralizes added acid and base in a biological sys
A: Buffer solutions often are weak acid/strong acid and conjugate base. buffers resis...
Q: In the Watson-Crick model of DNA structure: Question 5 options: T can form three hydrogen bond...
A: DNA means deoxyribonucleotides. DNA is a polymer of nucleotides attached together via phosphodiester...
Q: Circle and label the hemiacetal functional group and the acetal functional group in each of the foll...
A: Carbohydrate is a macronutrient that the body uses to generate energy and form complexes that are ne...
Q: Evaluating: Evaluate the following statements and determine which of them is FALSE about “agarose" *...
A:
Q: Deficiency in which mineral nutrient is responsible for Menkes disease? Phosphorous Molybdenum...
A: Nutrients are important for the growth of organism and to survive and reproduce. Nutrients are requi...
Q: Calcitonin reduces Ca+ from the blood
A:
Q: The genetic data below is the DNA sequence of part of a theoretical fungal genome. a.) Which strand ...
A: DNA is a double stranded molecular structure with anti parallel stands of polarity 5' --->3' and ...
Q: Below is a general outline of a soap molecule. Indicate on the outline the area that is expected to ...
A: A fatty acid is a carboxylic acid with a long hydrophobic aliphatic hydrocarbon chain and soap is th...
Q: Baby A was a term female infant born via uncomplicated vaginal delivery. • Maternal serologies were ...
A: Pregnancy: Pregnancy is a 36-40 weeks long incubation period for the growth and development of fetus...
Q: Match the following- A. Fibrous protein 1. Peptones B. Globular protein 2. Metaproteins C. Primar...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: In SOAP Experiment, Do you think the type of fat/oil used will make a difference in the product? Why...
A: Soaps are sodium salts of fatty acids and are form by the saponification reaction.
Q: What mechanism of antibiotic resistance does the NDM gene code for?
A: Antibiotic Resistance is the phenomenon by which any bacteria can survive in the presence of Antibio...
Q: In regards to the protein structure, explain what is meant by “tertiary structure.” What are the mai...
A: There are four levels of protein structure are important to attain the final 3- dimensional folded s...
Q: True or false? Initial velocity studies are particularly useful for investigating the kinetics of an...
A: Enzymes are protein catalysts. Enzyme kinetics explores how experimental settings affect response ra...
Q: 1. Isoelectric point of polypeptide: (1) is pH at which the o-carboxyl and o-amino groups are unchar...
A: Proteins are polymers made of monomers called amino acids, mostly L-amino acids. There are different...
Q: How are inhibiting agents different from those that denature an enzyme? Use the paperclip button bel...
A: Enzymes are proteins which increase the rate of biochemical reactions. All proteins become active on...
Q: If the disaccharide maltose is formed from two glucosemonosaccharides, which are hexose sugars, how ...
A: Carbohydrates are the most important macronutrients for most organisms. Carbon, hydrogen, and oxygen...
Q: Which of the amino acids will nearly always be found buried in the center of proteins? valine glyc...
A: Proteins are the polymers of amino acids linked by the peptide bond (CO-NH). There are 20 common ami...
Q: 8. In patients after prolonged hepatitis, the ALT and AST activities were measured in the blood seru...
A: Hi. Thank you for the question. As per the honor code, we are allowed to answer three sub-parts at a...
Q: 6-One method to determine proximity of two locations in a protein molecule or protein complex is FRE...
A: The principle mechanism of Florescence resonance energy transfer (FRET) is based on the transfer of ...
Q: Remembering: Chrysolaminarin is a storage polysaccharide of red algae a storage polysaccharide of di...
A: Carbohydrates are biomolecules that are important for energy generation in living organisms. They ar...
Q: Consider a peptide with the following amino acid sequence: H2N-ASENHLDGCPYTKSRG-COOH Analyze the p...
A: pKa: The logarithmic of Ka has a negative value, which is represented by the symbol pKa. pH is defin...
Q: The ammonium sulphate-precipitated phycocyanin (Sample 3) still contains a lot of other proteins. Br...
A: Phycocyanin - Accesory pigment to chlorophyll and is the pigment-protein complex belongs to phycobil...
Q: Based on the given results, what do you think is the isoelectric pH of casein? Briefly discuss your ...
A: Casein is a key protein of milk and present in large amounts in cheese. Proteins are polymers of ami...
Q: Unique features and function of: Cysteine Lysine Proline Glutamic acid or Glutamine Tyrosine Histidi...
A: An amino acid is an organic compounds that contain alpha amino and alpha carboxylate functional grou...
The proofreading of DNA is essential for faithful replication.
- True
- False
Step by step
Solved in 3 steps
- Linear eukaryotic DNA molecules have many origins of synthesis. True FalseDraw out the molecular structure of a double stranded DNA molecule. This molecule is 6 bp in size. Don't forget label.Compare and contrast the properties of DNA polymerase and RNA polymerase. Drag the appropriate items to their respective bins. can proofread using a 3'-to-5' exonuclease activity polymerize in a 5'-to-3' direction Only RNA can initiate strand synthesis catalyze phosphodiester bond formation to polymerize nucleotides into nucleic acids Only DNA use deoxyribonucleotide triphosphates as substrates can only extend an existing strand Both Reset Help dependent on a DNA sequence template use ribonucleotide triphosphates as substrates
- דוידודוודי www.www. The above image shows DNA during replication. The new DNA strand build using the top strand as the template would be considered ( Select ] v strand, whereas the new DNA strand build using the bottom strand as the template would be considered ( Select) strand. The lagging strand is synthesized discontinuously and is made up of small fragments called [Select ] v fragments. These fragments contain RNA primers synthesized by [ Select ) ( Select) replaces RNA in the primers with DNA and [ Select ] v glues the fragments together to form a continuous strand. inPolymerase chain reaction is— a reaction involving a chain of different types of polymerases acting successively on a DNA. a way DNA replicates in the living cell. governed by the Henderson-Hasselbalch equation. a chain reaction mediated by polymerase to amplify DNA fragments of defined sequence. DNA polymerization without a template.The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during polymerase chain reaction (PCR) replication. Which of the following options best represents the primer?5’ – CGCGTATCGGGCTGTCGCGTCTTGCAGCTCG – 3’ a. 5’ – CGAUACGC – 3’ b. 5’ – CGATACGC – 3’ c. 5’ – CGAGCUGC – 3’ d. 5’ – CGAGCTGC – 3’ e. None of the above
- Select the correct order of steps in a polymerase chain reaction. create reaction mixture, denaturation, extension, primer annealing denaturation, create reaction mixture, primer annealing, extension create reaction mixture, denaturation, primer annealing, extension denaturation, create reaction mixture, extension, primer annealingWhen comparing the three key models of DNA replication, the model that included the separation of the two strands of the original DNA (template) and using those strands as templates to synthesize two new DNA strands is called directional replication. dispersive replication. conservative replication. semiconservative replication.In the diagram below, which Okazaki fragment was produced first, A, B, or C? Fragment A Fragment B Fragment C A B C H overall directions of replication
- Explain how cells activate nucleic acids for polymerization. Explain why DNA is stable and why its structure dictates its replication mechanism. Explain why many RNA molecules exhibit tertiary structure, while most DNA molecules do not. Explain how DNA replication occurs from structural and enzymatic perspectives. Develop an understanding of nucleic acid biology outside a natural biological context (such as PCR, etc.)DNA ligase catalyzes the formation of a peptide bond without adding another nucleotide to the strand. TRUE OR FALSE. I BELIEVE THIS IS TRUE. AM I CORRECT ?dna stored at physiological ph is negative charge single strand positive charge unchanged degraded