Answered: The mRNA sequence that would correspond…

Name: 22 The mRNA sequence that would correspond to the DNA sequence 5' ATTC
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 22 The mRNA sequence that would correspond to the DNA sequence 5' ATTCGATCT 3'is 3' UAAGCUAGA 5'.TrueFalse

Science

Biology

The mRNA sequence that would correspond to the DNA sequence 5' ATTCGATCT 3' is 3' UAAGCUAGA 5. True False

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Related questions

Q: are you sure? i got 149

A: PCR means polymerase change reaction in which the main enzyme DNA polymerase amplifies a given DNA…

Q: Name plz

A: The long narrow and coil part of alimentary system that starts just below the stomach where both…

Q: advanced dysplasia?

A: The abnormal development in cell or organ of a body is known as dysplasia. It can occur all over…

Q: omote

A: A retrovirus is that virus which uses RNA as their genetic material. When a cell is infected with…

Q: What is atheroma?

A: It is a disease of arteries.

Q: paralectotype

A: Introduction Zoology is a branch of biology that focuses on the study of animals, including their…

Q: What is a usuai Y-incision?

A: Incisions are defined as the surgical cuts that are carefully made on the body of the person in…

Q: of the following images show a carbohydrate? Note: molecular biologists have many different ways o…

A: Biomolecules are the molecules of life. Small sized biomolecules are called as biomicromolecules.…

Q: how do you know if the duiretic was effective

A: Diuretics are drugs that prevent the reabsorption of water from kidney tubules and thereby increase…

Q: 12 15 13 14 16 17

A: Sperms are the male reproductive cells that carry hereditary information from father to child. It is…

Q: bleeding internally

A: It means that the blood vessels are damaged inside the body which leads to extravasation of blood…

Q: 9. Structure IV in Figure 12-2 represents a(n)

A: Transcription is the formation of RNA from DNA.It occurs in the nucleus of the cell. The translation…

Q: Heart beat activity

A: Heart normally beats in a regular rhythm.For an adult,the normal heart beat is 60-100 per…

Q: what is dick

A: The human male genital or reproductive system has two sections, the external and internal male…

Q: 2 3 4 10

A: The picture shows male reproductive organs ie, testis and it's cross section.

Q: What is Mondini's Dysplasia?

A: Hi, Thanks For Your Question. Answer : Mondini Dysplasia is Also Known As Mondini Defect or Mondini…

Q: 6. Contrast what is going on with the bacteria at arrow A with those at B. As you discuss your…

A: Bacterial resistance refers to the ability of bacteria to survive and grow in the presence of…

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

The mRNA sequence that would correspond to the DNA sequence 5' ATTCGATCT 3'
is 3' UAAGCUAGA 5'.
True
False

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
A mRNA sequence is shown below. Note that the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA where there are T’s in the DNA. The first triplet of nucleotides AAU (underlined) is in frame for coding, and encodes Asparagine. 45 50 55 60 65 5’—A A C G A A U C G U C G C C A A C U A A G A G –-3’ Which of the following DNA mutations is almost certain to result in a shorter than normal protein? at position 56 a change from G to C an insertion of a G after the G at position 56 inversion of region 56-59 (G C C A) an delete the C at position 52 None of the above.
The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG CAT CCT CCC TCC TTT CTT TAA TAT TGG-3' 3'-GAA AGG GTA GTG GCG TAC GTA GGA GGG ACC AAA GAA ATT ATA ACC-5' Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. (1) Use the table and write the sequence of the resulting peptide. (1) Is it possible for a codon to code for another amino acid? (1) What will be the effect if a mutation changes the codon UAU to UAA? (1) What is a reading frame? (1) If you are given a nucleotide sequence, how would you find Open Reading Frames? (1) DISCUSS the reason why there are leading and lagging strands in replication?
Using the genetic code below, decipher the following mRNA sequence. 5'CCCGGGAUGCGGUGUUGGUUUUAACCCGGG3' (show all work)
None
For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'
A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the following amino acid sequences
(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?