The mRNA has an additional information to make another protein. What is that protein? What is its function?

Q: Why would a protein increase mRNA levels? How would you test that to prove your theory?

A: The Central Dogma of Molecular biology states that information is transferred from DNA…

Q: AGGTATCGCAT is a sequence from the coding strand of a gene. What will bw the corresponding sequence…

A: The terms used in the question represents the molecules used during a gene expression. A gene is a…

Q: How is tRNA involved in protein synthesis? How genetic code helps

A: Transfer ribonucleic acid (tRNA) is a type of RNA molecule that helps decode a messenger RNA (mRNA)…

Q: Why can’t the exact sequence of mRNA be determined from a protein’s primary structure? thanks

A: Primary structure of protein  Primary structure of protein is comprise of linear amino acid sequence…

Q: To begin translation, the small subunit of the ribosome starts moving down an mRNA.  What feature…

A: INTRODUCTION Translation  Translation is the process of conversion of mRNA into protein. It consist…

Q: What is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your…

A: Trascription is the process by which the information on DNA is transferred to a molecule of RNA.…

Q: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

A: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

Q: the sequences od tRNA and corresponding mRNA  is complementary to each other. is the statement true…

A: The synthesis of a functional protein involves two processes namely transcription and translation.…

Q: What are Cyclin and mRNA? How are they related?

A: Cyclins get their name from the fact that during cell division, they go through a continuous period…

Q: Is there any complementarity between DNA and a transcribed mRNA? In which direction is the mRNA…

A: The transcription is a process by which mRNA is produced from the DNA. In case of prokaryotic…

Q: what enzyme is needed to make mrna

A:

Q: How is the relationship between the tRNA and mRNA described

A: Messenger RNA is product of transcription process. A process where all the genetic information of…

Q: Give the initiation codon for protein synthesis. Name the amino acid it codes for?

A: A genetic codon is a three-nucleotide sequence of either DNA or RNA that corresponds to a particular…

Q: Name and explain the process by which mRNA is formed.

A: Gene expression is the process by which information which is contained in genes is decoded to…

Q: What is the total size of the mature i.e. fully processed mRNA in nucleotides?

A: Primary transcript of mRNA contains exons as well as introns.  But After the process of splicing…

Q: An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start…

A: RNA (Ribo Nucleic Acid) is the genetic material found in prokaryotes and eukaryotes. It is the prime…

Q: What is the name of the cytoplasmic particles that translate mRNA into proteins? What type of RNA…

A: Ribosomes organize translation and catalyze the reaction that joins amino acids to make a protein…

Q: Shown below is the 5' end of an mRNA molecule. What are the first three (N-terminal) amino acids of…

A: Through transcription the DNA molecule is converted into mRNA.

Q: How does the transcribed mRNA convert into a functional protein?

A: Introduction: Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: A piece of mRNA is moving along the ribosome.  Which amino acid would bind if the mRNA read....…

A: The process of protein synthesis is called translation. It occurs on ribosomes bound to mRNA in the…

Q: Which characteristic of mRNA is INCORRECT? Bacterial mRNAs vary in size but usually have about 1000…

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: Problem 1: a) Given the strand of the DNA sequence below, REPLICATE its complimentary DNA partner…

A: DNA replication is described as process in which the double stranded DNA molecule is copied into two…

Q: How is the relationship between the tRNA and mRNA achieved?

A: Proteins are built from smaller units known as amino acids, that are fixed by three-nucleotide mRNA…

Q: What happens when one base pair of DNA is lost from the coding region of a gene because of mutation?…

A: This type of mutation is known as Deletion mutation in which a single or entire sequence of…

Q: Why mRNA is much more variable in its 3-dimensional shape than is DNA? does there is implications of…

A: Introduction  DNA and RNA are the main genetic material found in all the species irrespective of…

Q: What are the “protein synthesis factories?” Give an overview of the relationship between these…

A: Answer: The process of translating mRNA in to long chains of amino acids , proteins in the subunits…

Q: A pre-mrna containing just three exons will also contain.... introns? 3 2 1 0

A: Ribonucleic acid (RNA) is formed from DNA (deoxyribonucleic acid) by the process known as…

Q: Describe how the sequence of nucleotides in mRNA codes for the amino acids of a protein. How can the…

A: During the process of transcription the information from DNA is copied into mRNA for protein…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.