The igala kingdom
Q: Give answer to all parts only written answer
A: Introduction: A blood group, also known as a blood type, is a classification system used to identify…
Q: a) In a DNA double helix, why doesn't an A or T form two hydrogen bonds (out of the three possible)…
A: Since you have asked multiple questions with multiple parts, we will answer only the first three…
Q: Results: Table below showing the antibiotic susceptibility of E. coli Antibiotic Observed zone of…
A: Microbial antibiotic susceptibility refers to the degree to which a particular microbe (such as…
Q: Mandela Day
A: Nelson Mandela International Day was launched in recognition of Nelson Mandela's birthday on 18 July…
Q: 1. Discuss any two current trends and issues in nursing and health care with examples, and explain…
A: We know that A plan of care devised from evidence-based research is a clinical practice where the…
Q: What do you mean by profilin
A: To describe: To describe about profilin and its uses
Q: Sea otters importance
A: Introduction: Marine animals known as sea otters (Enhydra lutris) live along the coasts of the…
Q: Which plates are countable in the schematic? Sample 10° 1 ml 0.1 ml 9 ml blank TNTC 1 ml Ene the…
A: CFU stands for colony forming unit per ml. It depicts the amount of bacteria present in the culture.…
Q: influence of america in the philippines
A: The relationship between united states and Philippines has been described as special relationship.…
Q: Two example of pork breeds
A: There are many breeds of pig (Sus scrofa domesticus). Durocs have gained notoriety for being the…
Q: Animals which can be cut in any vertical plane through their central axes to give mirror image
A: Animals which can be cut in any vertical plane through their central axes to give mirror image is…
Q: Questions are attached
A: Pleural effusion It is the accumulation of fluid in the pleural space resulting from excess fluid…
Q: Animism is assigning life to inanimate object True False
A: Animate The word animate refers to the living objects. Inanimate The non living objects are also…
Q: Risk AEC (Identify a specific risk A AA that the hazard may Risk Reduction Strategy (what should be…
A: Hazard risk Risk assessment Riak reduction The source of hazard can be falling while climbing wall…
Q: Specific prevention. Exists or not. Briefly explain why.
A: A virus is defined as an infectious microorganism made up of a protein-coated segment of nucleic…
Q: Make concept map with the following terms. Be sure to include appropriate linking words. Email me a…
A: The study of the brain has long been regarded as one of the most difficult aspects of biology. The…
Q: As a student of genetics, you become interested in the phenotype of feathered legs in Black Langshan…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: The diagram below represent a diploid cell in an unknown female. The letters in the diagram…
A: In the independent assortment, traits are segregated independently. They never mixed with others.
Q: Occasionally, errors occur in meiosis which results in an incorrect number of chromosomes in the…
A: Meiosis is the cell division process that involves division of a diploid (2n) mother cell into four…
Q: Deontology theory about euthanasia
A: Introduction: Euthanasia is the intentional ending of a person's life in order to relieve pain and…
Q: Study the diagram below (figure1): Desert food web Hawks Desert foxes Scorpions Snakes Large lizards…
A: Introduction: A food chain is the sequence of biological community (an ecosystem) to obtain…
Q: Upon performing the F₁ cross, the F2 generation consists of 10 individuals, all of whom are…
A: Probability is the chance of finding the outcomes. Two rules exist for probability- the sum rule and…
Q: Part 2 Biology Question 2
A: The objective of the question is to identify the most likely genetic configuration of the Pitx1 gene…
Q: To produce transgenic bacteria that make insulin, which of the following steps didscientists have to…
A: Insulin is secreted by beta cells of pancreas. It allows glucose to enter the cells to provide…
Q: ii. ) If the lac operon in 'a' carried a mutation in the CAP binding site that rendered it…
A: First it has to be understood that : 1) the CAP-cAMP complex acts as a glucose sensor and is only…
Q: The 3-D structures of membrane proteins can be determined using SDS-PAGE.
A: Gel electrophoresis is the widely used technique in molecular biology for the separation of the…
Q: Classification of kingdoms
A: The kingdom in biology can be outlined as the system that is utilized by biologists for the…
Q: modern theories of myth interpretation on how COVID 19 myths were created
A: Severe acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2) is the most dangerous novel for…
Q: What part of the cartridge is found at the tip?
A: The cartridge or firearm has different parts having different purposes. Primer Rim Casing Bullet…
Q: 5' GTATGTTACGTAACCTCTGCCTGCTAAGGGTAGAATATAGCTACGCTATCGATGGTAGCTAGCGATCG 3' a b с 29) Examine the…
A: This question asks to identify the binding site for the transcription factor TFIID in a given DNA…
Q: In Andalusian chickens, feather color is inherited by incomplete dominance. I- one parent with black…
A: Incomplete dominance is a state in which, heterozygous state produces the trait which is mixture…
Q: Characteristic relation to carrying capacity. With each of the following characteristics, indicate…
A: The population growth depends on different factors, some of which are intrinsic factors and some are…
Q: Who is ligma
A: We are given the term "Ligma." We need to get information about 'Who is Ligma'? Whether it is…
Q: please help me do this English translation is below
A: Kidney- The kidney functions as an eliminative organ and helps the body to get rid of waste…
Q: Based on your knowledge of actions, identify if the muscle(s) that are synergists or antagonists.…
A: Humans have around 600 muscles in the body. The muscle system consists of skeletal, cardiac, and…
Q: Trivia about analogous structures
A: Analogous structures in evolutionary biology are biological structures with similar or corresponding…
Step by step
Solved in 2 steps
