The function to be built, amino_acids, must return a list of a tuple and an integer when given a string of mRNA code. The first tuple must contain all the amino acids and the integer must be the number of distinct amino acids. You can use the dictionary below to help with your function. The function must also not include the stop codon codes. NOTE : For this piece of code, we'll assume that there's only one stop codon in the sequence {'CUU': 'Leu', 'UAG': '---', 'ACA': 'Thr', 'AAA': 'Lys', 'AUC': 'Ile', 'AAC': 'Asn','AUA': 'Ile', 'AGG': 'Arg', 'CCU': 'Pro', 'ACU': 'Thr', 'AGC': 'Ser','AAG': 'Lys', 'AGA': 'Arg', 'CAU': 'His', 'AAU': 'Asn', 'AUU': 'Ile','CUG': 'Leu', 'CUA': 'Leu', 'CUC': 'Leu', 'CAC': 'His', 'UGG': 'Trp','CAA': 'Gln', 'AGU': 'Ser', 'CCA': 'Pro', 'CCG': 'Pro', 'CCC': 'Pro', 'UAU': 'Tyr', 'GGU': 'Gly', 'UGU': 'Cys', 'CGA': 'Arg', 'CAG': 'Gln', 'UCU': 'Ser', 'GAU': 'Asp', 'CGG': 'Arg', 'UUU': 'Phe', 'UGC': 'Cys', 'GGG': 'Gly', 'UGA':'---', 'GGA': 'Gly', 'UAA': '---', 'ACG': 'Thr', 'UAC': 'Tyr', 'UUC': 'Phe', 'UCG': 'Ser', 'UUA': 'Leu', 'UUG': 'Leu', 'UCC': 'Ser', 'ACC': 'Thr', 'UCA': 'Ser', 'GCA': 'Ala', 'GUA': 'Val', 'GCC': 'Ala', 'GUC': 'Val', 'GGC':'Gly', 'GCG': 'Ala', 'GUG': 'Val', 'GAG': 'Glu', 'GUU': 'Val', 'GCU': 'Ala', 'GAC': 'Asp', 'CGU': 'Arg', 'GAA': 'Glu', 'AUG': 'Met', 'CGC': 'Arg'} '---' represents the stop codons Example would be : 'AUGUCGGCACAUUUAUGCUCCUAAUCC' To give : [('Met', 'Ser', 'Ala', 'His', 'Leu', 'Cys', 'Ser'), 6] This is the summary of what is required from the challenge: The output must be a list of a tuple of strings (amino acid) and a single integer (number of distinct amino acids) Must use the dictionary to call the amino acid or stop codon Must convert the three codes into an amino acid and stop at the stop codon (the function assumes all the codes have only one stop codon) ### START FUNCTION def amino_acids(mrna): ### END FUNCTION test : amino_acids('AUGUCGGCACAUUUAUGCUCCUAAUCC')

Computer Networking: A Top-Down Approach (7th Edition)

7th Edition

ISBN:9780133594140

Author:James Kurose, Keith Ross

Publisher:James Kurose, Keith Ross

Chapter1: Computer Networks And The Internet

Section: Chapter Questions

Problem R1RQ: What is the difference between a host and an end system? List several different types of end...

See similar textbooks

Related questions

Question

The function to be built, amino_acids, must return a list of a tuple and an integer when given a string of mRNA code. The first tuple must contain all the amino acids and the integer must be the number of distinct amino acids. You can use the dictionary below to help with your function. The function must also not include the stop codon codes.

NOTE : For this piece of code, we'll assume that there's only one stop codon in the sequence

{'CUU': 'Leu', 'UAG': '---', 'ACA': 'Thr', 'AAA': 'Lys', 'AUC': 'Ile', 'AAC': 'Asn','AUA': 'Ile', 'AGG': 'Arg', 'CCU': 'Pro', 'ACU': 'Thr', 'AGC': 'Ser','AAG': 'Lys', 'AGA': 'Arg', 'CAU': 'His', 'AAU': 'Asn', 'AUU': 'Ile','CUG': 'Leu', 'CUA': 'Leu', 'CUC': 'Leu', 'CAC': 'His', 'UGG': 'Trp','CAA': 'Gln', 'AGU': 'Ser', 'CCA': 'Pro', 'CCG': 'Pro', 'CCC': 'Pro', 'UAU': 'Tyr', 'GGU': 'Gly', 'UGU': 'Cys', 'CGA': 'Arg', 'CAG': 'Gln', 'UCU': 'Ser', 'GAU': 'Asp', 'CGG': 'Arg', 'UUU': 'Phe', 'UGC': 'Cys', 'GGG': 'Gly', 'UGA':'---', 'GGA': 'Gly', 'UAA': '---', 'ACG': 'Thr', 'UAC': 'Tyr', 'UUC': 'Phe', 'UCG': 'Ser', 'UUA': 'Leu', 'UUG': 'Leu', 'UCC': 'Ser', 'ACC': 'Thr', 'UCA': 'Ser', 'GCA': 'Ala', 'GUA': 'Val', 'GCC': 'Ala', 'GUC': 'Val', 'GGC':'Gly', 'GCG': 'Ala', 'GUG': 'Val', 'GAG': 'Glu', 'GUU': 'Val', 'GCU': 'Ala', 'GAC': 'Asp', 'CGU': 'Arg', 'GAA': 'Glu', 'AUG': 'Met', 'CGC': 'Arg'}

'---' represents the stop codons

Example would be :

'AUGUCGGCACAUUUAUGCUCCUAAUCC'
To give : [('Met', 'Ser', 'Ala', 'His', 'Leu', 'Cys', 'Ser'), 6]

This is the summary of what is required from the challenge:

The output must be a list of a tuple of strings (amino acid) and a single integer (number of distinct amino acids)
Must use the dictionary to call the amino acid or stop codon
Must convert the three codes into an amino acid and stop at the stop codon (the function assumes all the codes have only one stop codon)

### START FUNCTION
def amino_acids(mrna):

### END FUNCTION

test : amino_acids('AUGUCGGCACAUUUAUGCUCCUAAUCC')

Expected Outputs

amino_acids('AUGUCGGCACAUUUAUGCUCCUAAUCC') == [('Met', 'Ser', 'Ala', 'His', 'Leu', 'Cys', 'Ser'), 6] amino_acids('AUGCCACCUUGA') == [('Met', 'Pro', 'Pro'), 2] amino_acids('AUGUCCCCUGCACGAGGGCCAUCCUGAUCCCCCCAU') == [('Met', 'Ser', 'Pro', 'Ala', 'Arg', 'Gly', 'Pro', 'Ser'), 6] amino_acids('AUGUGGCGACUCUAUCGCGUUGCCCGGUACUGAAUGCCACCU') == [('Met', 'Trp', 'Arg', 'Leu', 'Tyr', 'Arg', 'Val', 'Ala', 'Arg', 'Tyr'), 7]

Expert Solution