count_words(sentence): returns a dictionary with all the words in sentence in lower case as keys, and the value of each key is the number of times that word appears in a sentence. You can assume that sentences will only have letters, spaces, commas and dots.

count_words(sentence): returns a dictionary with all the words in sentence in lower case as keys, and the value of each key is the number of times that word appears in a sentence. You can assume that sentences will only have letters, spaces, commas and dots.

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Q: Implement the quadratic formula) function. The function takes 3 arguments, a, b, and e, and computes…

A: quadratic_formula(a,b,c): START determinant = sqrt(b*b - 4*a*c) x1 = ( -b + determinant)/2*a x2 =…

Q: 4 Yasmeen has an interesting new job. She is now responsible of validating registrants ages for the…

A: CODE: #include <stdio.h> int main() { // declare the 3 variables, k, x, and y // k =…

Q: Use Python You are planning to add bookcases to a wall in your living room, but you don't know how…

A: ALGORITHM:- 1. Create a function that takes 2 inputs first in feet and second in inches. 2.…

Q: C++

A: Coded using C++.

Q: C++ please: Passwords are frequently used as a common means of authentication. It is also known that…

A: 1. Define isAlphabetic(char ch) function: 1.1. Return result of isalpha(ch).2. Define isDigit(char…

Q: (C PROGRAMMING ONLY!) 6. Teaching the Dog To Sit by CodeChum Admin Ever since I was a kid, I've…

A: Hello student Greetings Hope you are doing great. Thank You!!!

Q: im having some trouble with this Requirements: Write a Python script that prompts the user for the…

A: - We need to code for the polygon area program.

Q: As we discussed in class, functions are used to divide a long problem/program into small programs.…

A: Algorithm: Define a struct named Worker, which has the following member variables: lastName…

Q: Lab Functions 2 Topics covered: C++ Program Development Practice, Loops, Functions and Arrays Lab…

A: Given , the answer is given below

Q: Procedure 3. - Define a function named procedure3() that will be called from main() function, the…

A: //both c and cpp codes are provided #include <stdio.h>//function procedure3 takes start,end…

Q: Write a function that simulates a guessing game as follows. The computer will generate a random…

A: Note: Follow proper indentation Comments mentioned in code for understandability Code: import…

Q: Programming Assignment #2 - Sigma Notation (Summation) This is an individual assignment. Evidence of…

A: Algorithm: Start the program Display a instructions. Loop until the user chooses to exit…

Q: This program should use a void function to print the integers from 1 to 100 (inclusive) in…

A: The program consists of function declaration and definition. The function declaration tells the…

Q: You have to make sure that all the variables you use in your solution are floats. (1.0 instead of 1…

A: ## SINCE NO LANGUAGE WAS SPECIFIED IN THE ORIGINAL QUESTION I HAVE USED PYTHON PROGRAMMING LANGUAGE…

Q: Topics: while, basic I/O, conditional structure, list, for loop Problem Statement: In this lab, you…

A: condition: Equality Checks if two If c1 = a1 - ib1 and c2 = a2 - ib2 are two complex numbers,…

Q: Which line of code compiles without any errors? while (int n; n < 10) {} while (n < 10) and (n == n…

A: Defined the line of code computers without any errors

Question

Implete the following function:

- Code should be in python

• count_words(sentence): returns a dictionary with all the words in sentence in lower case as keys, and the value of
each key is the number of times that word appears in a sentence. You can assume that sentences will only have
letters, spaces, commas and dots.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

Please code using C++ and only use the header <iostream>. The use of any additional headers will not be accepted. Thank you!
[Python Language] [Python Language] Is it time for tea?Your friend lives in London England in a timezone that is normally 6 hours ahead of Toronto Canada. But sometimes London and Toronto switch to daylight savings time on different dates. If Toronto is on daylight savings time and London isn’t, then the time difference is only 5 hours. Conversely, if London is on daylight savings time and Toronto isn’t, the time change is 7 hours. Of course, if both are on daylight savings time, the difference is back to the standard 6 hours. Write a program that takes three lines of input: a float value representing the time in Toronto, whether Toronto is on daylight savings time (1 means yes, 0 means no), and whether London is on daylight savings time (1 means yes, 0 means no). It prints a float giving the time in London. One complication is that you should not print a time greater or equal to 24.0 or less than 0.0. Suggestion: At first don’t consider this complication, and test cases where the…
C++ question 2 part c and d i need help w Please I will greatly appreciate it if you can help me with this. I really really can use the help to understand this thank you so so much.
make 3 codes using python: 2 ways to convert decimal into binary code and 1 way to convert binary into decimal code You are only allowed to use the following functions/methods: print(),range(), len(), sum(), max(), min(), and .append(). It is not mandatory to useall of these functions/methods.
Briefly explain overflow flag
Problem Statement: (The following problem is based on a problem in a number of Java texts, including the text by Gaddis.) Given a numeric expression in prefix form, develop a Java program to evaluate the expression. The following site provides some explanation on prefix expressions, as well as other forms of numeric expressions: Infix, Prefix and Postfix Expressions (Links to an external site.) Input Data: Repeatedly, enter one prefix expression (as a string) at a time at the keyboard alternatively, you may set up an input data file and get the data from the file Stop the inputting, when the user does not want to enter any additional strings NOTE 1: To simplify matters, assume that only non-negative integers are used the allowed operations are binary addition/subtraction, multiplication, division, and modulus operations Processing: Set up a method (or methods) to evaluate the given expression. Output Data: Echo back the entered input string, along with the result…
python3 program
-- Implement Logical disjunction (OR) using case expressions -- NOTE feel free to change the function declaration -- (pattern match on the arguments), just don't change -- the type decleration -- NOTE^2 You are NOT ALLOWED to use || please use elm
Python practice part 2:
For the following questions, you are only allowed to use the following built-in functions: print(), range(), and len() and do python Create a code that uses a function that computes and displays theresult of a fibonacci sequence.
In Python how would you return a value from a function?
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…